Borelis schlumbergeri
Calcarina gaudichaudii
Dendritina zhengae
Allogromia sp.
Shepheardella sp.
Parasorites sp.
Peneroplis planatus
Sorites sp.
Carterina sp.
Cyclorbiculina depressa
Baculogypsina sphaerulata
Bolivina sp.
Calcarina hispida
Calcarina gaudichaudii
Baculogypsina sphaerulata
Trochammina inflata
Patellina corrugata
Heterostegina sp.
Amphisorus sp. and Heterostegina sp.
Cornuspira sp.
Amphisorus sp.
Rhabdammina sp.
Pedro sorting forams

is the foram barcoding project?

Foraminifera are a highly diverse group of unicellular eukaryotes, characterized by a granular pseudopodial network called granuloreticulopodia. The majority of Foraminifera possesses a test (shell) that is composed of an organic, agglutinated or calcareous wall and has one or multiple chambers. Foraminifera are abundant and widely distributed in all types of marine environments, but are also present in freshwater and terrestrial habitats. Some species have developed symbiotic relationships with various groups of protists and bacteria.

The identification of foraminiferal species is mainly based on the morphology of their tests. Here we propose a complementary identification system based on DNA fragments specific to each species, called DNA barcodes. For each species present in our database, you will find its general description, photos, collection data, DNA sequences, and references to related publications. The database is manually curated and differs from other foraminiferal catalogues by including only species, for which both molecular and morphological data are available. Our objective is to provide a complete, high quality and freely accessible resource of information about modern foraminiferal species.


do we obtain the molecular data? Methodological approach

The barcoding region is situated at the 3’ end of the SSU rRNA gene and is amplified using the primer pairs s14F3 (acgcamgtgtgaaacttg)-sB (tgatccttctgcaggttcacctac). It is usually necessary to perform a nested PCR, replacing primer 14F3 by primer 14F1 (aagggcaccacaagaacgc). The barcoding region spans six foraminifera-specific hypervariable expansion segments, 37f, 41f, 43f, 45e, 47f, 49e that were shown to be sufficiently variable to distinguish closely related species (Pawlowski & Lecroq 2010). The length of the barcoding region varies between 1000-1200 nt depending on the species.

Most amplifications are done on single-cell DNA extractions. Because of intra-individual polymorphism, the amplification products are cloned and 2-3 clones are sequenced. Whenever it is possible, this is done for 3 specimens of the same population to evaluate intraspecific variation.

The 3’ fragment of the SSU rRNA gene with the six hyper-variable regions (in yellow) and the barcoding region (in red). The helix numbers (f – foraminiferan specific, e – eukaryotic) are indicated above the schema; the position of amplification primers is indicated below.

to contribute to the foramBarcoding Project?

We would greatly appreciate your contribution. A common effort is needed to establish a large molecular database that covers different species from various geographic regions and habitats. Foraminifera specialists with taxonomic expertise are invited to deposit well identified species to make them available to the foraminiferal community.

To contribute you can either send living specimens or specimens preserved in DNA extraction buffer supplied by us. For each species we need at least 5 specimens for molecular analysis and 5 voucher specimens for further morphological investigation. A form with detailed collection data needs to be filled in for each collected species.

Please contact Maria Holzmann for any further information.


are the coordinators?

The foramBarcoding project is coordinated by Jan Pawlowski and Maria Holzmann from the Department of Genetics and Evolution, University of Geneva.

Funded by
125 species – 346 specimens Browse the database NOW!