Specimens collected by “Xavier Pochon” (9)

Specimen 1610

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 1610
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Double Reef

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 1610 | taxon:126667 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataatattttaatattatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatgcataatatgtatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatattgaatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatataaaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggagtacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1629

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1629
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Apra Harbour

Barcode sequence

SSU partial

>Sorites sp. 1629 | genomic DNA | 1629 | taxon:1032493 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgtaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatatttaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1634

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 1634
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Habitat soft sediment
Location Guam, Piti

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatttattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgccttaatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatttttatattttaaatatataatatagcataaaattaaagggaccgctgtctaaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatacaaatatatattttattatatatttataaaacctatttcgaaagtaaattggtaatcatttaaaaatcgtgattaataaaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggactattttaatatatatttatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 1634 | genomic DNA | 1634 | taxon:128073 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatgatgtaaataagttatttaattattttggataactaagggaaagtttggctaatacgtttaatttttaaatatgtttaattacatatacatataataaaaatcatttttttattgcaacatgatagatattatataaattaaaaatatatatttatttatatattttaaatagaggagactttataattattaattataatattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtactattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgatatttataccttgtattactatactcaatatatatatattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtaatattttatatattatattgcttgataatataccaatgttataaaatattgaatctgaatgcggtgaatataataatatcaagtaacatgtataaaatatttaattattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatatatatataatttatttttatacaatactgtgaacaaatcaaagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgcattaataaaataatattttatattttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatatatttattatatatttaatttatatttcttctcaacataattatatatgattgagcgtattatatatactctcatattttaatattaatgttataaaaaaatataatttaaattaaaaaactattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggagatcaatatatattatgtaaataatatattattgtaatccttaattataaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatttattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgccttaatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatttttatattttaaatatataatatagcataaaattaaagggaccgctgtctaaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatacaaatatatattttattatatatttataaaacctatttcgaaagtaaattggtaatcatttaaaaatcgtgattaataaaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggactattttaatatatatttatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1635

Species Miliolida > Soritidae > Amphisorus > Amphisorus kudakajimaensis
Isolate number 1635
Collector Xavier Pochon
Identifier Jan Pawlowski
Collected on July 1999
Location Guam, Double Reef

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatgttataaatctaagggacttataatatttattttaggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Amphisorus kudakajimaensis | genomic DNA | 1635 | taxon:1005670 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagtatgttataaatagttatgtaataggataactaagggaaagtttggctaatacgtttaattttacacatgtaaatatgcatataataatattgcaacatgatagatattatataaatataaatataaatatttatttatattaatatagagcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatataattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaggtaacatgtataaaatatttattattttatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattaacacacattactttttgtaatgttaatactgtgaacaaaccagagtgtataaaacatgtaatattatatatattatgcaatgaatgttttatcatggaatattgtttatttcgatggagatagttggagttaagagtacttataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataatatattattcttaatacccctaacatatttaatatttattgattgagataattaatatatttatctctcataaaatataaaataatatagtggtacaatatttattatatgtactttgagctcatataattaatataggtgagatgtaagcattataggtgaacaatatatttatattataaatattattggaatccttataaataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatgttataaatctaagggacttataatatttattttaggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1636

Species Miliolida > Soritidae > Amphisorus > Amphisorus kudakajimaensis
Isolate number 1636
Collector Xavier Pochon
Identifier Jan Pawlowski
Collected on July 1998
Location Guam, Double Reef

Barcode sequence

SSU partial

>Amphisorus kudakajimaensis | genomic DNA | 1636 | taxon:1005670 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatatttattttaggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1645

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 1645
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Luminao Beach
Latitude, Longitude 13.13, 144.644

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 1645 | taxon:126667 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaactcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatgcataatatgtatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatattgaatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatataaaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1678

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1678
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Apra Harbour

Barcode sequence

SSU partial

>Sorites sp. 1678 | genomic DNA | 1678 | taxon:1032494 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattcttttattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatatttaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaaactaaatatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1686

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 1686
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Pago Bay

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 1686 | taxon:126667 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatgcataatatgtatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatattgaatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatataaaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 2264

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis spp.
Isolate number 2264
Collector Xavier Pochon
Identifier Maria Holzmann
Collected on March 2000
Habitat Reef rubble
Location Guam, Gun Beach

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis sp. 2264 | genomic DNA | 2264 | taxon:128067 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaatatatataaataaatgttatctttggataactaagggaaagtttggctaatacgtttaatgtattaataatacacattcatataataataatacaacatgattgatattatataaatataaaatacatttattgtattttaaatagagatgactttataatatttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttaatatataatataaaaatatacactcaatttaattgaggcagtgacaagctgtaaagattcaatataaaaataaagataacatttggaattgtcgctttataatatttatattatattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgaatgtaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatatacacaacactgtgaacaaatcagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgctaataatatataatataatataaacatgttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatagatatataccctcaacttaaatattaatatgattgagtataattatatactctcatatatatattaatgttgataaatatttgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattaatgattaatatacttataatttttaataattataatgtattattatgatttaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI