Specimens identified by “Beatrice Lecroq” (1)

Specimen 9264

Species "monothalamids" > Clade CX > Shinkaiya > Shinkaiya lindsayi
Isolate number 9264
Collector Jan Pawlowski
Identifier Beatrice Lecroq
Habitat soft sediment
Depth 5435m
Location Japan Trench off Sanriku
Latitude, Longitude 38.14, 147.0

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Shinkaiya lindsayi | genomic DNA | taxon:525825 | small subunit ribosomal RNA ctcaaagattaagccaagcaagtggctatgataacccaacagtttaaataagtgattatttattcgaattttttaaagttttgttttacaaagcgtttattcatttatgcaactgcaaacagctgcttaatatagttacacttgtcttgacttggcgttcatatttgtataattttttatattgatattagatattaatttgatttctctgtaacattttttattgttataattttaaatttttaaaagttttggataactcagggaaagtttggctaatacgtacgagaattaatatttttgatattcataattatgtttttttggtgtatatttttttaaagtatatttttgtgttgttaaatattttgattgtgatattttctatataatactgtgattattttttgtctttaaatttgtttgaggagacaaattaatttgattattgataaagatttaggtattaatggtcgacacctaggattttattagttttagctgtcgagcatttgtgataatctttgttttttaatttttaaagattcaaacattcaaatagttttaagaaataagaaatatgtatttctagattgttgtaaataatatcgtgtgtaatcataaatatatgaaatataatttaatataaaatatagtttgatctgaattgatattcggattttttgttgttaataattgtggattttttatgtcttcagcacttatcggtaaatttttattgaaatttaatagctacgtgaaatgacgataagtacgcgtgtatttaatatgtgtttacatatattgattacaacattgctgagcagactttgcgaagtgaaaatctaagcgaagcatgtcatacaagcatctagagcatcaagtcaccgggttggcaagtgtatttttgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcaaagtccattgagagatcgctcttagttctaaggaacgcagcaggcgcgtaatttgcccaatgctagtaccctattattattagtattgtattgtaatttttttgtgataacgtatatgcatatgcgttattactagtgttaatgattttatccttgttttctatgtcgatgtaattataatataatttttttagttatttactgaggcagtgacaagctgtaatggttgagtataaataagacaaacgtataaattccaatcttgtttttagcaagttatttaacttttgcgttttgtgtactcaattagaatgcggtgagtttaaacaactcagaacctttaaatggtattagagattatctttagctatttatgtatctgaatttcaagtggagggaaagtctggtgccagcagccgcggtaataccagctccactagcctatacaattattgttgcggttaagaggctcgtagttggattgaacaaaattttaattttacggtaaacaagatttatgatttattttagtaaatcattttttgttataattgagtttgattgtattgtggtttgtcactaatctttaaatttgattatttatgttatatattttaaatcattttttgttataattgagtttgattgtattgtggtttgtcactaatctttaaatttgattatttatgttatatatttcaacactgtgaacaaatcagagtgcatcaaacatgtngtaaaagtgcaatgcatgaattatcatggaatgttgcatgttattagatgttttttggtgttttttaaatattatgaggagtggtacactagaaagtaagattgtcaaatgtaatttttttattttgtgtatatgaatctgtaagtttttttatgtgagtaaggttgtatgatatgatgtacgatttatatttaattgtaaggctttttgcttgctaaacagaattatatggagtaatatgtttgccgaaaccgtgaaagtaagccatagcgtgaaggtaatcattgaaatatgagtattcatttgaaaatgagctttattactatatacatttttttntggagtaaggttgtatgatatgatatgatatgtgataaatataatgtatgatacgatgtacaataaatataatcgtaaggctttttgcttaataaacagaattatatggagtaacatgcttgccgaaaccgtgaacgtaagccatagcgtgaaggctttattactataaatatttttttctggagtaatgttgtattatatgatctgtgatgaatatgattgcgtggtttttgcttgataaaagaattgtgtacgagtaaggctgtattatattatatacaataaacagaattgctaaaatattttaaaaatattnaaaatatctatgtcgatggggatagttggagtcaagagtactgcttggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcgcttgactaggctatactctttgtgttgtttttgattttatatattttatatttcatctaaatttcactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcataagcattaagttgtttttgccctcaatctgcaaaatatttggtttgagcttgtgttaagtttaacacgctcactatttttcgtatggtttcgaaggacatttcatttatataatttcgttgcgtgtaagtattataatattacttgaaatattagtaatatgtgtctacacatgattgtttgagctttgcgctcatattattggtgagatgtaagcactagatgaacgtttgctgaatataagcagaaagttttttgttttttgttctagtataacttttgtcatgtataaagtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaattcgcccttacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggatatactgaagattgacaggaaataatgattagtttttaaactcttacatttaatttgctggtcctttcataatagtatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgtgtaggacttaatactcaacagtgtgctactttacaatacccttggttgttgtgaaatttatctgtagtgagggttttcgcatattgatatattttttgagtaagtacatcttaagccctgaacgcaacgaacgtgaccgcaaccctttgtaactaccttttggaaaattgcgcctggatttttttcaggtttttgtgattagctaacttaggggactgctgcgatttcttttaaaccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcacctcatttaataaaactgatcataagatcgaaagattttttattggtcagaatgggcctgcctcgaaagagtgtaggtaatcaatacgaagtaatgatttctctgattacaaattttatttgtttttgatagcacacaatatgctaacgctatatctctgaatattagtaaaaatattttttgttgacttttttgtttaaagtggcaaatttatatttttgaaatttggtgtgttatagttttttagtatgtgctttttgtcaactcttggtggggacagaccattgtaaattgttggtctcgtcttaactaggaatgccttgtacgggttttggtttaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttaagggactaatatgatttcattatagaaacttaaacgaacagtgcggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI