Specimens collected by “Juan Montoya” (3)

Specimen 2456

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis spp.
Isolate number 2456
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat soft sediment
Location Cuba, Cayo Levisa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagaggcgatagtttatattttatattaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataagtgaatgcaacgaacgtgaccgtacccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis sp. 2456 MH-2008 | genomic DNA | 2456 | marine sediment sample | taxon:577509 | Cuba:Cayo Levisa | 23-Jan-2001 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatataagtaaatagtttatcttttttggataactaagggaaagtttggctaatacgttttaaatgtatttaataatacatatgcatataataatattattgcaacatgatagatattatataaaatgatatattatgtatatcataagagcagactttatatttttttaaataatataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaactcaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaattgaatgcggtgaatataataatttcaagtaacacatgtatttgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataataatatatattttatatattaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattactatttaaataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgattgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagaggcgatagtttatattttatattaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataagtgaatgcaacgaacgtgaccgtacccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 641

Ammonia sp. T1_641, spiral view Ammonia sp. T1_641, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T1
Isolate number 641
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat salt marsh
Location Cuba, Playa Bailen

Barcode sequences

SSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 2 | true | Cuba:Playa Bailen | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgtcgtgcgttgagctctctcgggggccgagcgcatgactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcataaaaagagacctagtatacgcgtaagatatcgtttacggttcgtgacccccttcgggcgtgtgtcgcacgtacgtatcatacgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgaatgtatgcatcttcgggtgtatctaccgctgcttagtgcgtatgcgtacttcggtgcgtgtcgtacattaaactatagagaccgctgtattttttttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccacggtatgtatttatgcttcggcgtagtatatatcagttggtcggccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactnccatagaccatggtacacacttatatatgtacgcgcaggttctacccggccngcctttgtgtcggtgcagtgcgtancgngntntttcgtacgtancactctgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtctcacctaggaatncctggtacgggtctccggttcaacataccacccngaaaagatcccncccctttgaacncnccgcccgncnctctaganaanngannacactangaatntatagcactcccaaaggtgtnnggncccggtaagntagngganatagatacgaatagtgtgannnnnnnnaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 1 | true | Cuba:Playa Bailen | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggcgcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacagatatacgtcgtgcgttgagctctctcgggggccgagcgcatgactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcataaaaagagacctagtatacgcgtaagatatcgtttacggttcgtgacccccttcgggcgtgtgtcgcacgtacgtatcatacgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgaatgtatgcatcttcgggtgtatctaccgctgcttagtgcgtatgcgtacttcggtgcgtgtcgtacattaaactatagagaccgctgtattttttttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccacggtgatacgtttcggcgtatcattagttggtcgaccacgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggtacactctttatgtacgcgcaggttctacccggccggcctttgtgtcggtgcagtgcgtagcttgttgtttcgtacgtaccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtccctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaattgttgtacctcggtaccgcgcttagtggaaatatatnnnnntagtgtgatctaaaggaaagagaagtcgaaca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 1 | single cell | true | Cuba:Playa Bailen | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatacccaatatataccatctgtgcgtacctcggtgcgtacaaattttagcccgtcgatactatcctagcatagtactggcttcggccggtaacctatctatgcgggaattgtagcatcgtacaaaaatatattatacaacgtatatacgcaacccacacttatatatatttttatgcgtacacttactttcataaacacacagcgctcccgcgttggaaagcaagtctatatcctttttggatatgccatagagtgtgacggccacgtttcaactctctacgtatacgcatgcgttatatacatacactgtattttatatataacctgagtnaagttattt

See sequence on NCBI

Specimen 647-Amm

Ammonia sp. T11_647, spiral view Ammonia sp. T11_647, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T11
Isolate number 647-Amm
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat salt marsh
Location Cuba, Playa Bailen

Barcode sequence

SSU partial

>Ammonia sp. 647 | genomic DNA | 647 | marine sediment | taxon:155846 | 6 | true | Cuba:Playa Bailen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcgcgacctcgcttcggcgcgagtcacgctggaagacgctagatctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatccaaaaagagaccaagtatacgcgtagaaccacgtggtagtgaccccctctttaaccggaggcgtgtgtcgcacacgtattatacgcactggtctcggatagcaacgaacgtgaccgtactctattgttgcagtgaaacagtgcttgccttcgggctcgcacgacccactgcttagtatatatgcgcttcggcgcataatatacattaaactatagagaccgctgttttttccttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcaaatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaaagtgcgtggacaacaacacctgcgcggcttcggccgtgcgtgtgtatgattgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaaaataaagtacgcgcaggtctacccggctccgcctttgtgcagagtgcagtgtgtagcttgttgttttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagcgcttgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 647 | genomic DNA | 647 | taxon:155846 | 13 | single cell | true | Cuba:Playa Bailen | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataaaatatatatgccactcgttggcgtataatttagcccgtcgatactatcctagcatatttacctacggcttcggctgttcgtaaaataatatgcgggaattgtagcatcgtaataaaaaaatatacgtacaacacgcacaccgcaacgccataagcgtatataaaaagaaccttacttgtaaacacacagcgtacccgcgttgggaagcaagtatatatccttttggatatgccatagagtgtgacagccacgtttcaccctataataaaaggtcatacgcataacacaccgatacacccaaatggcaatgcatcgtgcataccgtacgaaaaatatattttttatataacctgagtcgagttattt

See sequence on NCBI