Specimens collected by “Werner Piller” (1)

Specimen 206

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 206
Collector Werner Piller
Identifier Werner Piller
Collected on June 1996
Location Red Sea, Safaga, Egypt

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 206 | genomic DNA | 206 | taxon:1032489 | SSU rRNA | SSU rRNA | SSU ribosomal RNA ctcaaagattaagccatgcaagtggttataataaccagaatgtttaaattagtgttatataatatataatatatatactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatgtaaataataatagttatttatttggataactaagggaaagtttggctaatacgtttaaaatataataatacattatgcacataataataatattaatatatgataaatattatgtaaataagagtattttttttactctaatagagcagactttataatattttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttatactaaaactcaatatataatatttttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatgtaataattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcytatacaatcattgttgcggttaagaggctcgtagttggattgaatacattttttaatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctttttaatataatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattacttgtttctctatatttaattatttattataatataattgagtacttaattgtttactcttatatttaatatatattatttttataattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataagtgagtaatatataagtaatattatattattatgatctttatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttttaatggaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtagccttttattgctattattatttaattatagcataaaattaaagggaccgctgtcattactaaatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatatactttataatatataatattatattaatacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattctaattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI