Specimens collected by “Roberto Sierra” (7)

Specimen 12249

Bolivina skagerrakensis_12249 Bolivina skagerrakensis_12249
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12249
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 1 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA cgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagnctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagnncattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccnnccggaataaatnncccnccccctttgnacacnccncccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaactcgcgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 2 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaaactcgcgtatcatattaggaaacttaaaaaaacagtgtggtctaaaggaaagagaagtcgaacaaggc

See sequence on NCBI

Specimen 12250

Bolivina skagerrakensis_12250 Bolivina skagerrakensis_12250
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12250
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12250 | taxon:673208 | 4 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatctcatatgttctgcgtgtgaggtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatcataccctcggatatgacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactgcctgtgatattcgcgtatcatattaggaaacttaa

See sequence on NCBI

Specimen 12251

Bolivina skagerrakensis_12251
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12251
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12251 | taxon:673208 | 7 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacacgctcgcgttgtaggtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatagggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttctatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatattatatattgcttcggcgtgtgtagtgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatcttcacggatacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgatatattgcttcaccgtgtgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcga

See sequence on NCBI

Specimen 12268

Globobulimina turgida_12268 Globobulimina turgida_12268
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12268
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial


See sequence on NCBI

SSU partial


See sequence on NCBI

Specimen 12270

Globobulimina turgida_12270
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12270
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial


See sequence on NCBI

Specimen R3

Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R3
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R3 | taxon:944431 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggac

See sequence on NCBI

Specimen R6

Liebusella goesi_R6 Liebusella goesi_R6
Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R6
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 4 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttnntttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacctctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 5 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI