Specimens identified by “Elisabeth Alve” (7)

Specimen 12249

Bolivina skagerrakensis_12249 Bolivina skagerrakensis_12249
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12249
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 1 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA cgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagnctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagnncattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccnnccggaataaatnncccnccccctttgnacacnccncccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaactcgcgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 2 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaaactcgcgtatcatattaggaaacttaaaaaaacagtgtggtctaaaggaaagagaagtcgaacaaggc

See sequence on NCBI

Specimen 12250

Bolivina skagerrakensis_12250 Bolivina skagerrakensis_12250
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12250
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12250 | taxon:673208 | 4 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatctcatatgttctgcgtgtgaggtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatcataccctcggatatgacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactgcctgtgatattcgcgtatcatattaggaaacttaa

See sequence on NCBI

Specimen 12251

Bolivina skagerrakensis_12251
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12251
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12251 | taxon:673208 | 7 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacacgctcgcgttgtaggtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatagggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttctatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatattatatattgcttcggcgtgtgtagtgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatcttcacggatacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgatatattgcttcaccgtgtgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcga

See sequence on NCBI

Specimen R3

Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R3
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R3 | taxon:944431 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggac

See sequence on NCBI

Specimen R6

Liebusella goesi_R6 Liebusella goesi_R6
Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R6
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 4 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttnntttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacctctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 5 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI