Specimens collected by “Sam Bowser” (4)

Specimen 111

Species "monothalamids" > Clade I > Astrammina > Astrammina rara
Isolate number 111
Collector Sam Bowser
Identifier Sam Bowser
Collected on June 1995
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtattatwatttataattttattattatattttattaatacgttatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccaaatagacttttctattgatatcagccttawyacttttgaatttataatatatatttaatcataattttattattatgtgccaatattattttatttttttttaaaggtaaggatttgattcaaagtaaaacgtggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatattaatatttaaaatgattttattattgttttatttattcttatttatatgtgttatgtatttgattgtatgtgaatgtatgttacatgtatttaatctgatgcattcattgtggttatatatatatatgtatttatacatgaatttattcgtgtattttatatatatatgtgattatagtgagtgttttggttttatacgtgtggtgtattttatttatatattttaatcattttatataaattgaggctaactagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagattattaaaataattatattatgaaaagtgtatttatttatattttgatttttatattatttataatttaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatataatataaaatttattttttatttgtgtttatttaaaattgatgcacacttttatgtctatgtttctatttttacatgttagaatattaatactatttattaatagtttaatttttaattttgtgatagttactgacatgtgctctcatattttaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttaagggactggtttgaattaatataatttttttagaaaatttattttttattattatattatattatattcaggctatggaaacttatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Astrammina rara | genomic DNA | 111 | taxon:46078 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA tctcaaagattaagccatgcaagtggtttgcaacccgacggtttgaataagtgttaatttactttttaattaagtttatatatattatatatattatattattattataaacttttttaattaaaagtgatatataatctttgatttttatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttcgcactgtaaaatgtttatatttaaggtgtttttatatatatatttatatatatttaaatgcattttaatatataaacaaaatatgttactttaaagagcaataatattttatatattgttgttttttttggataactaagggaaagtttggctaatacgtacgagttaattagaattatattaaatttaaaatgatatatatatattatttatatatattgttttatttttattattatttcattattactttttgcacatattggagcagtgaagtattatatatatattatttatattgttatatgtattatacatatatatgttatccttttaactaagtgaaaatatgtattgtatatatatattcaatattaagtataatgtttaatactttataacttaaatgttaagctgcattcatgcaacatgagagacaatatgtacgcgaacatacctttgttttaaaatgtaattattattaatatataatttaattattatatattgtatttttattattttaaagcatgctttatggtatatgctgagcagacttgcgaggaatcatacttgcaagcaggtcatacaagcatctacggcatcaagtcacagggtcggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtccccttttattatatatatttaattatgtgtataaacattgtgtgtaatttgcatatttaatttataaattatatatatatattatatataatttaattaaattgtaaatacgaacacttggttttcaaactcaaaaaaaataaaaataaagaacaatttatttacattccttgttatattgtttctcttttatttttaatatagatatattatatatatatattaattttactgaggcagtgacaagctgtaacagttgtagctttaaattaatgtaagggccttggatttgtcacttctttgaagtgttacagagccggcttttacctgctcatctggaatgcggtgagtctaagcaattcggaacagttggtgtgtctttacggacataacaataatccgaactcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttttttattaatttttgatataattatgtatatttatttatatatgattatattaaaaaattaagctgagatttttaaataatatatttatatttatatttaatatattgtttgaaaaatattcaagttgaatttgtgttattcaaattcatatttttattttaataattgttgttttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtatttgattgtgcattgaatgtcttatcatggaatgttgcaactcgaatatattatatatatgtatatgatacaatcttaattgaaaataaaattatgtatttttatattatgaatgaatacttttttgttttaaaacaatatttatatgtatatatatatgttttgaaatgtcgatggggatagttggagtcaagagtactgctgggcgagaggcgaaattcggtgaccctggcaagactaccaaaagcgaaagcacttgactaggctatcctctttgtgatttatatgtatatatttatatatatatattatattattgttataatatatctttattataatagtataaatgtatatatatttatatatatatattaaaacactttacaatgaagaacgaaggttgggggatcaaagacgatcagataccgtcgtcgtcccattaattacatcaaacgatgggcactcaattgcatattgagatattgtttgataatgccctcaacctgcaaaatcagggcttgtagcgttgttttatcagtttataaattttttatataaatgattattttattataattattttgtttaatattgttagattgttcaattgctcgcctgtatttgtatacggacttgaaggcattttttgcaagcgtgcagcattcttttaaaatgttattttataatattataaattttatttatatatatttattatacctttttatatttatagtaatgcaagcacttgattttcggagctttgcgctcttttggtgagatgtaagcgacaaagacgtcttatagtttgtattatttttgatatatatgtattttcttcatagtaatattaatattgaatataatttatcaaactaacttaaacggactctttactgttgtgaggcacgctttaggcacgcgcttactgcagaaatgtctgagtcattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtattatwatttataattttattattatattttattaatacgttatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccaaatagacttttctattgatatcagccttawyacttttgaatttataatatatatttaatcataattttattattatgtgccaatattattttatttttttttaaaggtaaggatttgattcaaagtaaaacgtggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatattaatatttaaaatgattttattattgttttatttattcttatttatatgtgttatgtatttgattgtatgtgaatgtatgttacatgtatttaatctgatgcattcattgtggttatatatatatatgtatttatacatgaatttattcgtgtattttatatatatatgtgattatagtgagtgttttggttttatacgtgtggtgtattttatttatatattttaatcattttatataaattgaggctaactagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagattattaaaataattatattatgaaaagtgtatttatttatattttgatttttatattatttataatttaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatataatataaaatttattttttatttgtgtttatttaaaattgatgcacacttttatgtctatgtttctatttttacatgttagaatattaatactatttattaatagtttaatttttaattttgtgatagttactgacatgtgctctcatattttaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttaagggactggtttgaattaatataatttttttagaaaatttattttttattattatattatattatattcaggctatggaaacttatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 118

Species "monothalamids" > Clade I > Astrammina > Astrammina triangularis
Isolate number 118
Collector Sam Bowser
Identifier Sam Bowser
Collected on June 1995
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtaatttattatattcatttataacatattacattatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccttatagacttttctattgatatcagccttaatacttgagaatgatcgtgttatatatatatatatatatganttaattttcgtatattatattatataattatgtgaattttttgagctaaggatttgattcaaagtaaaagctggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatgatatatttatttgttttattacatttaaatgtattatttatatgtgttatgtatttgatagtatatgaatgttatgtgacatgtgtataatattatatatatatatatattatatatganatgatttgtattgttagaatttattttaatgatattaaattatattatatatatatgtgtatatgtggtttttatacgngttatatgattttntttatgtatttaatcattttgcataaattgaggnaaacgagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagtttattatgattatatatttatatattataatgtatttatttatgttattttatattatattaattgtttattctaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatgtatttcaaatttatttttttaatatgtttatttaaaattgatgcacacttttatgtctatgtttctattaacatattaggatattaatactatttattaatagtttaatttctaattttgttatagttactgacatgtgctctcatgttttattaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactggtttgaattttaaagtatatgtatatttatttatatatattactttttatataattcaggctatggaaactcatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Astrammina triangularis | genomic DNA | 118 | taxon:46080 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggtttgcaacccgacggtttgaataagtgttaatttacttttaatttaaaaagtttaatatatgtatattaaactttttttgttttaaaagtgatgaaaattcagtttgtttatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttcgcactgtaaatgtttatgaattggggttatatatatatttatatatatataattttaatttatgaacaaaattgttactttaaaagataataatatattttaatatgttgttgttttttggataactaagggaaagtttggctaatacgtacgagttatttgaaatgttataatataattatatcttttaattatattatattatttttttttactttttgcacatattggagcagtgaagtattatatatactatttatatttgtatttatattaaattgtgttttacatgatttatatatatatgaatttcatgaatataatatttaatgctttataacttaaatgttaagctgcattcatgcaacatgagagacaatatgtacgcgaacatacctttgttttaattattatattaataattaatatatatcatgactttattgttatgtttatatttttatttttatatatatttattacatgctaatggtatatgctgagcagacttgcgaggaatcatacttgcaagcaggtcatacaagcatctacagcatcaagtcacagggtcggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtcccctttttatatattaattatattaaaagtttaaacattgtgtagttttgcatctttttttttatatttatataaaaaacaaatataaaattaaaatgtaaatacaaacacttaggttttcaaacaagattattaaatgttataataatattacattccttgttatattgtttctcaattaaaaattaattcattatttaattaatatattcttttttactgaggcagtgacaagttgtaacagttgtagctttaaattaatgtaagggccttggatttgtcacttcttctgaagtgttacagagccggcttttacctgctcatctggaatgcggtgagtctaagcaattcggaacagttggtgtgtcttcggacataacaataatccgaactcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttatttttttattaatttttttattataattatatatttatatatgattattttaaataaaattaagctgatattttaaattcaatattatataataatattagttgatttaaaattgaaagttttaattataatatgattaattaatttatttaaaacacgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtatttgattgtgcattgaatgtcttatcatggaatgttgcaactcaaataatatatgtatttatattgatactacttttattaaattaaattaaatttaattatatattgattctttttgatttttttaatataataatactgtattaattaattattttaatatgtatattttattttaaatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcggtgaccctggcaagactaccaaaagcgaaagcacttgactaggctatcctctttgtgattttgattatttaatataaaagatttgtatatatatatatttatatttatatatataaatttaatatattaataattaaaaaacactttacaatgaagaacgaaggttgggggatcaaagacgatcagataccgtcgtcgtcccattaattacatcaaacgatgggcactcaattgcatattgagatattgtttgataatgccctcaacctgcaaaattcagggcttgtagcgttgtttaatcaattttattttgatttacttttattaatataatataaatatttattatttgtattttttaattcaattttaattaaatttttaattgttcaattgctcgcctgtatttgtatatggacttgaaggcattttttgcaagcgtgcagcattctttgaaatgtttatattaaatttaattattttattaattataatttctttatatcgttttatattatagtaatgcaagcacttgattttcggagctttgcgctcttttggtgagatgtaagcgacaaagatgtcttataacttgtgcttaattatttgattttaatgttttcttcatagtaatattttaattgatttaagcgtaagttagcttaaacggactctttactgttgtgaggcacgctttaggcacgcgcttactgcagaaatgtctgagtcattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtaatttattatattcatttataacatattacattatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccttatagacttttctattgatatcagccttaatacttgagaatgatcgtgttatatatatatatatatatganttaattttcgtatattatattatataattatgtgaattttttgagctaaggatttgattcaaagtaaaagctggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatgatatatttatttgttttattacatttaaatgtattatttatatgtgttatgtatttgatagtatatgaatgttatgtgacatgtgtataatattatatatatatatatattatatatganatgatttgtattgttagaatttattttaatgatattaaattatattatatatatatgtgtatatgtggtttttatacgngttatatgattttntttatgtatttaatcattttgcataaattgaggnaaacgagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagtttattatgattatatatttatatattataatgtatttatttatgttattttatattatattaattgtttattctaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatgtatttcaaatttatttttttaatatgtttatttaaaattgatgcacacttttatgtctatgtttctattaacatattaggatattaatactatttattaatagtttaatttctaattttgttatagttactgacatgtgctctcatgttttattaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactggtttgaattttaaagtatatgtatatttatttatatatattactttttatataattcaggctatggaaactcatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 340

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 340
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 340 | taxon:162490 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacga

See sequence on NCBI

Specimen 343

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 343
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 343 | taxon:159871 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacga

See sequence on NCBI