Specimens collected by “Jan Pawlowski” (119)

Specimen 1082

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 1082
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 1082 | taxon:162490 | 6 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacgaacgtgaccgcagcctcttgttgcctcccttgtgcatgctgcattgtgttttgtggtagtgttttcatttttaatgaattcgccatgttacgctttcagttttgccacagttttttcaactgtatgtattatcttatgcctgtntggtgttttagagttgcactatgcgtatgtggttgctacaaatggtgatcgtgtgcgtttgtgtgacatcttggcgctgcttttagggtatattgcatgtgcgtacaaagaatttatctgcagtggagggaaactagagggaccgctgactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagtttcagttacactgatactttaaagggtattggttgtgtgttgaaggttttgcctttatacgcatggcttttacctgttggtgttagctggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatatnttatatatgtcctgtattttaaggctgttttctcttttagagattacaatttacctctattatacggtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgttttcaactaggagtgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttcactgtgagtttgagggactggaaaccctttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1087

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1087
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, Explorers Cove

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1087 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgccacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1087 | taxon:325275 | 1087.4c | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggagacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaagga

See sequence on NCBI

Specimen 1145

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1145
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1145-4b | taxon:324130 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttcatattccttcgcgggttcgtgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1145-3 | taxon:324130 | small subunit ribosomal RNA ggcatattaatatatacttttttctattccttcgggttcgtgttaaatgtctatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccattcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgatattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacatattaatttctgtgcaagaaagcttattaaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataaacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaattgaattatttgcaagtgaagcatctcatatatatatatataacaccgcatgcgcgagtccatttattcagtttctctacccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacc

See sequence on NCBI

Specimen 1148

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1148
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.56 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgctcgcgcattcagtataaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacgggagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtattcacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgtt

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.2b | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctggttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaagccacccggaatacgtccctgccctttgtacacaccgcccgtcgct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.57 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcnnnnnnnnggctcgacgttggattgaactgcaatatgaatgaattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaatttttcctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacacacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatggcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgccgtaaatattttctcacacacacacacacacacacgtacatgtttacatagcccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactcttttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcgacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagctgcttcgaaagtaagtgggtaatcaattagaagtaatgaatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | 1148.1c | small subunit ribosomal RNA | s14-sB region cactgaggattgacaggcaatattagtacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttacagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcgattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacg

See sequence on NCBI

Specimen 1188

Species "monothalamids" > Clade C2 > Gloiogullmia > Gloiogullmia sp.
Isolate number 1188
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Gloiogullmia sp. 1188 | genomic DNA | 1188 | taxon:164091 | 11 | single cell | Sweden:Tjaerno | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatcgtttttatcttttaaaacattcgcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtctcatactggacttagaaatcaagtgtgtttatttttcttgtgcggttatgttttaatgcattttgttaccccatttttttgggtgagtttcaatttgtgttttacattccgtgctttattgataaataaatacacatctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaaaacatttttttttattttttttactttaatttcttgttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacagcactgttttcattttttttttaaaatgagcagtcaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaatttatttttgattttgtgagcacacaatatgctgctcccctccctggcatttagctttttgtctatttgtcattgtgtgtggggatgctcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagttttttttattttttttttaatttgaaaaaagctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1225

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 1225
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 1225 | taxon:159871 | 19 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacgaacgtgaccgcagcctcttgttgcctcccatgtgcaaactgcattgtatttctgcgtgttgtactttagggtataatatgtgttatgctttcggtttttgccacagttttttcacttgtattcatttcgtatatctttggtgatttgcgaagactacttggatttatatttgtgttatgtggtcgcttcaaatgcggctatgtacacttttgtattttccttgtatgtctctctgttgcttttgagatatatttgtttatgtgtacatcgaaattatctgcagtggagggaaactagagggaccgctgactctttataaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctacccagttcgtgtgcacagtttttcgttacattaatactttaaagggtatatattatgcatgtgttggtggcgtctttcgctagatgccctgatatgtgtgtgtgttgcctgttagtgttagcgggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatattttatatatgtcctgtattttatgggtgttttctcttttcagagtttacgtctccgtattattcagtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaaactccttttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 12285

Leptohyalis scotti_12285
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12285
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12285 | marine sediment | taxon:998810 | 4 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattattttatataatataaattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgnncngtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12285 | marine sediment | taxon:998810 | 5 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaaattgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtccttttcnngattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattattttatataatataaattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12287

Leptohyalis scotti_12287
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12287
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12287 | marine sediment | taxon:998810 | 7 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatctaccgggtccggacacactgaggattgacaggtattatcaataattatttttacatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcgatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattttttttataaaatattattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtattttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacctctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12287 | marine sediment | taxon:998810 | 8 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12288

Leptohyalis scotti_12288
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12288
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12288 | marine sediment | taxon:998810 | 25 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagttcctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12288 | marine sediment | taxon:998810 | 26 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaatcattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttatttcgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagttcctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12290

Leptohyalis scotti_12290
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12290
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12290 | marine sediment | taxon:998810 | 29 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaatcattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttatttcgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggcttcttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12290 | marine sediment | taxon:998810 | 30 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgtcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12291

Leptohyalis scotti_12291
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12291
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequence

SSU partial

>Leptohyalis scotti | genomic DNA | 12291 | marine sediment | taxon:998810 | 16 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttacatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattttttttataaaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcctcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcgntttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12292

Leptohyalis scotti_12292
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12292
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12292 | marine sediment | taxon:998810 | 33 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgtaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgccttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtggggaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgacttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12292 | marine sediment | taxon:998810 | 34 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgtaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgacttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaancatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12301

Eggerelloides scabrum_12301
Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12301
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12301 | marine sediment | taxon:160331 | 16 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatttatttatttatttacgcctcgcgcgtaaaaaaattttaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacacacaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcgattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12301 | marine sediment | taxon:160331 | 17 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttnctnnattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaacttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaaataataaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcacggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12303

Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12303
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12303 | marine sediment | taxon:160331 | 5 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcagcgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggngngatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgtaactttgacccctaattttaattaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12303 | marine sediment | taxon:160331 | 6 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgnnataggtggtgcatggccgtccttagttcgtggagtgatctgtctgcttaattgcgcttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 1282

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1282
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Depth 2m
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Sorites sp. | genomic DNA | 1282 | taxon:126664 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatttatttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgaaaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccggccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1305

Sorites sp._1305
Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1305
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Depth 20m
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatgatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattattatttaattatagcataaaattaaagggaccgctgtcattactaaatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites orbiculus | genomic DNA | 1305 | taxon:87144 | Israel: Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatataaatatttgatagttatttatttggataactaagggaaagtttggctaatacgtataaaatataataatacattatgcacataataatatttatatatgataaatattatgtaaatgaaagtatttttttactttaatagagcagactttataatatttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttttaaaaactcaatatataatatttttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattacattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttcaattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatacattttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctttttaatataatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagatcattctctttgtattattacaatgaagagcgaaggttggggggacaaagaggatcagataccctcgtagtcctattttcacatcaaactatgggatttcaattactgtacacctctatatttaattatttattataatataattgagtacttaattgtttactcttatatttaatatatattatttttataattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgagtaattataagtaatattatatattatgatccttaataaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatgatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattattatttaattatagcataaaattaaagggaccgctgtcattactaaatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 13112

Bolivina variabilis_13112
Species Rotaliida > Bolivinidae > Bolivina > Bolivina variabilis
Isolate number 13112
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on November 2010
Location Mediterranean Sea, Porquerolles, France

Barcode sequences

SSU partial

>Bolivina variabilis | genomic DNA | 13112 | marine sediment | taxon:212447 | 1 | France:Porquerolles | 18S rRNA | 18S rRNA | 18S ribosomal RNA cacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaacatcacacgtattcgtacgtgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggatctatataccgtgcatgtgttgcggcattgacccctcagtatatctcatattgagtgcgcgtctttcgcttagctcactgcgctttagatcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcatacccaatgcgggcaatatacactcgtatatatagttcgcataagaaagcttattattatacacaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactacaccgcatgcgcgagtctatttattcttcggtctaaatacgatctctgcgcgcggtaaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctattttttttctgcacacatatatgtggcgcatctacccggcttgccttgttgcaagttctttgtgcgtagatgtgtaccttttccacatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtcattggcgcttatattacgcttcggtgtgatatacgccattctaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina variabilis | genomic DNA | 13112 | marine sediment | taxon:212447 | 2 | France:Porquerolles | 18S rRNA | 18S rRNA | 18S ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaacatcacacgtattcgtacgtgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggatctatataccgtgtatgtgttgcggcattgaccccccagtatatctcatattgagtgcgcgtctttcgcttagctcactgcgctttagatcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcatacccaatgcgggcaatatatactcgtatatatagttcgcataagaaagcttattattatacacaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactacaccgcatgcgcgagtctatttattcttcggtctaaatacgatctctgcgcgcggtaaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctattttttttctgcacacatatatgtggcgcatctacccggcttgccttgttgcaagttctttgtgcgtagatgtgtactttttccacatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtcattggcgcttatattacgcatcggtgtgatatacgccattctaggaaacttaaacgncngtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13131

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13131
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 13 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggtttaatttgactcaacgcgagagatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgtcccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 16 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatataagtttatatatttaatttttatatgaaaatatgcgacctttttcnnnntatgagaaagggggcgnagcgccgctcatgattnnnngagagatctgtctctttaattgcgtttcactaagggctttatttataacacgtgtgggacggcactttgacccttttgttgcagtaaaatatatgngataaatatgtgcgtgtcttagtattgagcttagtctcgcacaaatgagtcctgaaagcaacgaaacgagaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtactctttttaaaccagaagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagagagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 14 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatattttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggttaatttcactcaacgcgagaaatcttactgggtccgtacacactgaggattgacattcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgtttcttagttcgtggagtgatctgtctgctttaattgcgtttcactaagggcttatatttataatacgtgtgttgacgggcacttttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgtagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggacccgctgtaatctttttaaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccggggctgcacacgtgctacaatgattattgcagtgagcatcccattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13132

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13132
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Eggerella sp. 13132 | genomic DNA | 13132 | marine sediment | taxon:998801 | 20 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaaacctgcttcgaaagtaagngggaaatcaatttgaagtaatgatttnccgtaaaatataaatttattttatatttaatagcacacatatatatanncggcatctttacccaacgcacagcttgtctgtcgtttcgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccngaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatgctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13133

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13133
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13133 | genomic DNA | 13133 | marine sediment | taxon:998802 | 23 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatctggtatgcgtcactacccactgcttagcgtgtacgtaccttcccggtgtgtcgtgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcggctatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttcgggccttctgtgccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacgcaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13133 | genomic DNA | 13133 | marine sediment | taxon:998802 | 24 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcgtgtacgtatatcccgtatgcgtcgcgcactaaacctatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctacgcgggtaatccattagaagtaatgactcgctttagaccttggcacgatatatgtgcgcgcgggctaaccgttgtaacctctgtgttactccagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatangaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13136

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13136
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Eggerella sp. 13136 | genomic DNA | 13136 | marine sediment | taxon:998803 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattctaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggggcgtggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgctccgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13195

Spirotextularia.sp_13195
Species Textulariida > Incertae sedis > Spirotextularia > Spirotextularia sp.
Isolate number 13195
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 1 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatcatattcataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacgattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacatttaaacgcgtgttatgtatttttatacatttcacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgtgtccaattatttacgtactatttcagtgcgtactttaattgtgtacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttaccccgcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtatctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 2 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatgctnntantcctttcatgattatgtgataggtggtgcatgccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgatcgcaacctcttgttgcctttatatacatttaaacgcgtgttatatatttttatatatttcacgtaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacacaccgcatgcgcgtgtccaattatttacgtactatttcaaatgcgtactttaattgtgtacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatatatgcacacatatatacggcatctttacccngcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 3 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatncgnnacccntttcntgattatgtnanaggtggtgcatggtcgttcttaggtcggggagggaacngtctgcttaaatgccnttnactnaaggnttaaaaatatannngtgtggnantgntttttgncccctatcgttgnaatattacgtgnagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgngaccgcaacctcttgttgcctttacatttaaacgcgtattatgtatttttatacattttacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggktgsggcaataacaggtctgtgaagsccttagaagttccgggcygcacacgtggctcaatgattattgcagktggcatctcatttatttcacaccgcatggcggtgtcccattatttacgtactatttcaagtccgaccttwawtgtgtaccattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttacccngcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 4 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagctgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacatttaaacgcgtgttatgtatttttatacatttcacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgtgtccaattatttacgtactatttcagtgcgtactttaattgtgtacattgcgcgcggtaaagccctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttaccccgcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccccccccgnatnnggtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13207

Spirophtalmidium sp._13207
Species Miliolida > Ophtalmidiidae > Spirophtalmidium > Spirophtalmidium sp.
Isolate number 13207
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtgggtgtatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggacttgnttgtagcttaagccggtgaaatgannnnnngagaacgaacgtgacccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 1 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnatgtggcttannnnnnctcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcagtattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 2 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaacagcgcgtggagctgtggcttanntngactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttagaaacaaggcaaataatatacagaggctctatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggnnnnnnnaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 4 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctctatatatataatataggggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggancgctagaaatactcgttaaaacggaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccatatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 5 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcaagtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggncgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatntccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgngnncnnnngtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13213

Siphonaperta sp._13213
Species Miliolida > Hauerinidae > Siphonaperta > Siphonaperta sp.
Isolate number 13213
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 26 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggnnnatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgnttnctttggcgacttcggtcaaaagggaagnnttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagantcccgcctgtgcttgtggtacgccacgagtacggtttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccnntttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgaagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 28 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccgacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 1325

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 1325
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Habitat Reef sediment
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

>Peneroplis pertusus | genomic DNA | 1325 | marine sediment sample | taxon:46137 | 1 | USA:Florida Keys, Conch Reef | Apr-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 1359

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 1359
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 1359 | marine sediment sample | taxon:128053 | 7 | USA:Florida Keys | May-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggtcgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaaataatacacttggccttaactaggaatgccttgtactcttctttggtttaacattccaagaggaatacgtccctgccctttgtacacaccgcccctcgctcttaccgatgaattatattataaatctaaaggacaaacagattcctaaattgaatacattgaatcttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 1361

Species Miliolida > Soritidae > Amphisorus > Amphisorus hemprichii
Isolate number 1361
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Amphisorus hemprichii | genomic DNA | 1361 | taxon:126669 | Israel: Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaaaatgttattttatttttataggataactaagggaaagtttggctaatacgtttaattttacacatgtaaatatgcatataataatattgcaacatgatagatattatataaatataaatataaatattttatttatattaatatagagcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatataattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttattattttatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattatattttacattacttttgtaatgttaatactgtgaacaaaccagagtgtataaaacatgtaatattatatatattatgcaatgaatgttttatcatggaatattgtttatttcgatggagatagttggagttaagagtacttataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataatatattattcttaatacccctaacatatttaatatttattgattgagataattaatatatttatctctcataaaatataaaataatatagtggtacaatatttattatatgtactttgagctcatataattaatataggtgagatgtaagcattataggtgaacaatatatttatattataaatattattggaatccttataaataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1363

Species Miliolida > Soritidae > Amphisorus > Amphisorus hemprichii
Isolate number 1363
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

>Amphisorus hemprichii | genomic DNA | 1363 | taxon:126669 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1366

Species Miliolida > Soritidae > Amphisorus > Amphisorus hemprichii
Isolate number 1366
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999

Barcode sequence

SSU partial

>Amphisorus hemprichii | genomic DNA | 1366 | taxon:126669 | Israel:Eilat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacagccgataatccaataaacatatatattatatgtatattggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtgaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1368

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1368
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Depth 1-2m
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatttatttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgaaaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 1368 | genomic DNA | 1368 | taxon:128051 | Israel: Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatataaatattaatagttatttatttggataactaagggaaagtttggctaatacgtttaaaatataataatacattatgcacataataatatttatatatgataaatattatgtaaataaaaaatacttttagtatttttaatagagcagactttataatattttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttagtttaatttgaactcaatatataatatttttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatacatttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctttttaatataatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattactacctcttttataaacatttaatcatttattatatataattgagtacttaattgtttactcttatatttaatattattatttttattattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgaataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatttatttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgaaaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1396

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 1396
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 1396 | taxon:313611 | 1396.3 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgttgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgccacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcattttatttcagttccattcatttggttctgtttttaagtgtgtttttgcttctgcgcgcggtaaagcctactttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaaggcgtaacaaggcatcggtaggtga

See sequence on NCBI

Specimen 1404

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1404
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequences

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 7 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggggtgtgtcgcacatacgttatacgcatagnnnntaggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgattcttctttaaaccagaggaaggatacsgcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgccttggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatatcatcatagtagaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 8 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgnnggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcacgattatgtgataggtggtgcatggccgttcttagttcgcggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggcgtgtgtcgcacatacgttatacgcataggtctcagatagcmaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 1405

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1405
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | marine sediment | taxon:155775 | 11 | true | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcntgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctcgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtaaaaccatatggtttgtgaccccctcgttaagaggcgtgtgtcgcacatatgtgttatacgcataggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagcatatagctgcgtcttaccaacgcgcaatatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcgcacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaccttcgcttgcgagggttagtggaaatatgtatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | taxon:155775 | 9 | single cell | true | Israel:Taba | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactatgtgcataatttagcccgtcgatactatcctagcatattaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaatatttatatacgtataacctacgcacacacacacatacctaaccgccaatatgtttctacgtactaggcaccttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcgcccatagtacgcgtataacatacacacacacatacacccaatggcgcgccggcagtgcagtgcacgtaaccatactgtatatatataacctgagtcgagttattt

See sequence on NCBI

Specimen 1850

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1850
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.4b | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaagaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgaggga

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.26 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.7 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattcggccgcactagtggatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcgagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaattttttctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacgcacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcatcnctgtgaacaaatcaagtgtatcaaacatgtcrtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgacgaaaatattttctcacacacacacacacacacacgtacatgtttacatagccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcactcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattcttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1994

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1994
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, Explorers Cove

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1994 | taxon:324130 | small subunit ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttttttcattccttcgggtatgttaaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggngcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaanaaagctttttaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgnacncctatggaaacttaaacgaacag

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1994.4 | J. Pawlowski 1994 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctacattaacccgacagtttaaataagtgttcatgctatcacgcataacatgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattagcataaattttgtttacgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacacactcacacgtatacactactcagcactcartggtaaactttgatttacgcgtattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgttcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgcacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacacacatccttgtccacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagt

See sequence on NCBI

Specimen 2112

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2112
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2112 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Explorers Cove | 77.58 S 163.51 E | Nov-1999 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaaccaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggactcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccactcggaatatgtccctgccctttgtacacaccgcccgtcgctcttatcgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 2114

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2114
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2114.5 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, New Harbor, Tile Hole | 77.34 S 163.3 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtcgcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaacttttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattacagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgttggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 2187

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 2187
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 2187-1 | taxon:324130 | small subunit ribosomal RNA agaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttgcattccttcgggtatgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttanttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacntatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattangtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactanagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcnntttctctaccttcacgggtatcgctgttttaaatgtgtatctctccgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgattcctttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttacttttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaacacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 2187.3 | J. Pawlowski 2187 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctcaagattaagccatgcaagtggttacattaacccgacagtttaaataagtgttcattgctatccgcataacacgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattaggcataaattttgtttgcgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacacacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacactcacacatatacactactcagcactcaatggtaaactttgatttacgcatattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgtctcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacatccttgttcacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI

Specimen 2632

Species Robertinida > Robertinidae > Robertina > Robertina arctica
Isolate number 2632
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2001
Location Svalbard

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Robertina arctica | genomic DNA | taxon:551669 | 18S ribosomal RNA rbrtnactcaaagattaagccatgcaagtggttataataacccgatagtttaaataagtgttataaattttgagaatcgcttcaaaaattgtactttaaacacacctcttttgacgattcagagcaaaatttcggatgataacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgactttggcactcgatcaaatcatctttgattcatacactcactgggccagaactaacacttacagtcacctgtttttgtcttctgggttccctttattgaattatcgatgtttttgtttgatacgacaaaaagatttctctgtagcggttcttatattttttacgaaatatttcgacgttacatcgtgcattttacttttcggataactcagggaaagtttggctaatacgtacgagcatctttaatcttacacacccacaccactctctgcacaacgagaaaagatcttttactcagcacttattggtaaatgtttgatgcgctttcgagtgcatctttcaacatttaaaagcaacatgagagacaataagtacgcaggattgggcatttcttgtcctttccatacgctgagcagactttgcgaagttcacttttgcgaagcaagtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagtaccctacaatatgtaataccatcattcacaaaattttttaacacacaattttctctgtcaactttaatccttgtcagactgaatcaattaattaaccttgtgaattcattttctcatattattttactgaggcagtgacaagctgtaacggttgagtataataatgacgagtgtctgacattgccgcctgcttctgtaggcttggcagtctgtcgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttgtaaaaagcattgttcttgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaactttaaaaacacaatttcaggtttcttcggatctcgttctgatgtaatacgcacacgtacccacgtcagcaacgttctttgcggattcttgtttttgatttttatttaccaaagtttgtagcacaagacactttgtctttttctagatgaagtgtgcttgtacgacgctgttaattgtattcggtcttgaatgacaaatatgatttgcagtctgatacacaaacgaaataaagatcttaccatttttatcgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcttttctaaatgtgcattgaatgttccatcatgggatgctgcacttttaacactttcttttcccatgttttgctaaccactcacactgtagctttacaaccgggtaaaacatgtgaaggcatgtgctatacttcatactgtcttttgaaaagaaaacagttataaatgtcgatggggatagttggagtcaagagtactgttgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgatgtcagtgtttgaagatacacgctactcgcgtatcatggttatttgcggagcaattaacgttagttgcgtattgccaactttcgagagattgttagagtgaacggcaacggatactgttgttgttatcgcatttattcattgatcgcaatttgcacttcattcatctggttacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttttaaatattaattgcaaatgccctcaacctacaaaatattgaatattttcgttgcttgagctagtgtctttattgatacgctcgctttgaatttatttgttttcgtacggtctcgatggacgtttcgattaaaaaatctaattttttgcgtgtatgcattttgactttatcttcattgataattcattgcgtgcacttgattttcggagctttgcgctcaaattttggtgagatgtaagcactgtgtcattctacacgagaactttccgttcaatttattgttcggacttgcttcatcgtttgtagtctgatattttttcaaataggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 2976

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2976
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2976.7 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, McMurdo Station | 77.51 S 166.65 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgatgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2976.6 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, McMurdo Station | 77.51 S 166.65 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagtcgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3183

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3183
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound, Gneiss Point

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3183.1 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtcgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgatatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3183.12 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagccctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgggcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3183.11 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgatgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3184

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3184
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound, Gneiss Point

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3184.3 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3213

Species "monothalamids" > Clade C > Rhizammina > Rhizammina algaeformis
Isolate number 3213
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Rhizammina algaeformis | genomic DNA | 156 | taxon:525823 | small subunit ribosomal RNA ctcaaagattaagccangcaagtggntcttacctgacggtttgaataagtgttctcgcatagatttgatcagtttttgttccgttcatttctattctatttctgtcttttttacattgnctcacattcacttgtgcaactgcagatagctgcttaatacagtctcacttgtcttgacttggcattcgtttgctattcacatttcttctttctctctctctctttctaccatgtctgtgaaagcaattttggtgtgttcgcactgttaacacttcctactggataactaagggaaagtttggctaatacgtacgagantcacttttctcttctctcttctctcttctctctctctctctctctctctctctcatttgcacttattggtttgtggaccggatctttttgtatttctggtttcacagtagcctcatgantgacaataagaacgcactaagcaatctttctgagattgttgctgagcagacttgcaatcatctttttgcaagcatgtcatacaagcatctacagcatcaagtcacagngttggcaagtgtctttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagcctcttgtggacttatcatcttggacaagataaaacaaaactgattcgaattttccgttgaatgctttttgcnttcgtggtcttattcttcttacttctttctctttctctctctctctcttattctttatttctgtcttgttgacaccttcttgtttgacgatttggactggctcgttcacacgagttggtctgatcctttcattgaggcagtgacaagctgtaanttttgagtatgcttaaagaacgggtgtgtagacactgtcacttcgtgattcgtgactccgccnaatatgtgctcatttggnatgcggtgaatttaagtcattcggagtgagtggtgtccttgtttggacatcacaaacatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttaatatgaaaacaaattttattctttttaatagaaatagatttgccttttttttattatacgacatacaattttacacacacatttatttttattatcatcattcttttttatttttcaacactgtgaacaaatcagagtgtaccaaacatgtcgttttacgataagtgcattgaatgtttcatcatggaatgttgcacttctaacatttttatatgtatatttttttngtcatttagttacactacacatttggttaacgtggcaataaaaggtatattattataaaaatatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgaatattttcctttttaaattattacacacactattaattnttttaaatggaaatttcccactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcatatacttttgaatgctattgccctcaacctgcaaaaattttgtggttcgagcttatgttatatttttatgacacgctcacctatttattttagtacggtttcgacggacatttcatttatatattttttgcgtgtaagtatttttaatattgcttgaaacattagcaatatgtgcctgcacatgattttctgagctttgcgctcatattatttggtgagatgtaagcactagacgtgggctactttcagcggctgtgcgcaggtattaatttatcgccgtagctttgtttgattgttcagcctttcgttattttaatggtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 3334

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3334
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.23

Barcode sequence

SSU partial

>Foraminiferan sp. W79 | genomic DNA | W79 | taxon:212481 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI

Specimen 3338

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3338
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3338 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3339

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3339
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3339 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3553

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3553
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 6326m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -58.5, -23.58

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3553 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattatagcactgtagtccaactagtctttttctgtttattcaggatttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattattaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3599

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 3599
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctntttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatc

See sequence on NCBI

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattacactctcacgcacacacacacacacacacacacgagattcgttacggtagtaacaatttcagcgtgaatcacctttacacagtgaatcactgaaattacccattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcatttcaaacaggagagagaatttattttttcccgcctgctttgaattgcatactatcacacatgctgattgttgcaatcattcgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtatcacacacacacacacactcgcacacattttatgattcgctctcacgtggcgacgtatctttttctctcacacacactacaccccgaatcgattacrtaccgcgagagatcacacagtgtttcattttttatgtgtctgcaacacatcaactactcarcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgacttcggtcacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttattatcattttgtattactattgcgttatacaacaatttacaacacacacacactagatgtgatgtaatatatatagcactatattttaattctgtcacctacacacagaaatacatccttgttcgttgttttttttcacgtaacgcaaaaagtcaatttcttgattttatgtttttactgaggcagtggcaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaacttgagtgaattctatttcatctcgattttgtgagtaacttacgcgtaactttttttttatagattcgcacctcgcgtctctttagatttttaattttatgcgttcgacgctgtttagaacacacgctaaattttttacacggcactcactcgcctttagaatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagccttaggaagaaattccactgcatacgttctcgcacacacacacacacaccgcagctcatatgcaggcgacgcacatgttaataccgccgcgtagatttttatttcttcttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatattttttttatgcacacagcacacagcatacacacacacacacacatactgtgtcgccccgtgtctcaaaaaatatatacactttacaatgaagaacgaagggttgggagatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttctcgtaaattgcaaatttcctcagctacaaaatgaattggcttgagctcgtattattcgtaatacgctcgcctcactattttcgtacggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcatactgcccgcagcgtatgccttcgggcatttcgttctgtcgtgtgtagttgacaattttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctctttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 3600

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 3600
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.4 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacaggcaatattaaatactactctaactatactctcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgttgtattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcatatgttccattcatttggttctattgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgtagcttctgtgcgtatagatgttgaatacacactttttgtgttatattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.5 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactctaactatactcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtgtaattgcgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatattttgctttattgcaattttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactctaactatactcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgctgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccatcatttgggttctgttttaaagtgtgtttttgctctgcgcgcggtaaagcttactgcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.2 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.6 | small subunit ribosomal RNA | s6-s14 region ccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgccatgaagaatgaatcttaacacctttctactctttgtgtcaacagttttacgtatatgttttgggcttatagttcatttcatatacgttcgacgctgttataagaattttgcttacgcatatacgatttttacacggcacgttagcatacacgcgtatatacaacctacacatacacacccacatttcgttgtatataccgtgtgtgacacacgcagcacttaatttcagaaatgtcttttcgtttgcatttgtgtgtgagacacactttggagcatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcgcactttcagccttttagaaagaagcctctcagcttttttctctctctcactcacacatacacacacacacacacacatcgtgaggaggcaaatactataagcgtatctttttttctaaaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattgtattacgctattagtatctctcacacacacacacacacacacatgtggtaacactaattatgcgtatatacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcaatttctatatagaattgtaaatttcctcaaactgcaaaataacttggcttgagctcgtatcattcttgatacgctcgcctcacttttttcgtacggtctcgacggacgtttcattttatcattttctttgcgtgtaagcattatgtatttattccttgaaacataggaattacattgcgtgcacttgattttcggagctttgcgctcaaatttctggtgagatgtaagcactgtgtttctctgcccgcagcgtatgactatcggtcatttcgttctgtcgtttggtagtttaacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccg

See sequence on NCBI

Specimen 3623

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 3623
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 3623 | J. Pawlowski 3623 (UniGE) | taxon:349561 | small subunit ribosomal RNA gattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgc

See sequence on NCBI

Specimen 3790

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3790
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on January 2003
Habitat soft sediment
Location Antarctica, Ross Sea, Terra Nova Bay

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3790 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Terranova Bay | 74.4 S 164.04 W | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtcgcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3791

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3791
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3791 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatcttccctttactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtgatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3792

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3792
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3792 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatctaccctttactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3804

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3804
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3804 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatcttcccttgactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3974

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 3974
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on June 2003
Habitat soft sediment
Depth 60m
Location Scotland, Creag`s Hole
Latitude, Longitude 56.28, -5.3

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 3974 | taxon:1051367 | 1 | United Kingdom:Dunstaffnage | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgaaagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttgctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcctacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcaggttcttttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcantttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggccatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3998

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 3998
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on June 2003
Habitat soft sediment
Depth 60m
Location Scotland, Creag`s Hole
Latitude, Longitude 56.28, -5.3

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 3998 | taxon:1051367 | 1 | United Kingdom:Dunstaffnage | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcgggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaangcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 3998 | taxon:1051367 | 3 | United Kingdom:Dunstaffnage | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcgggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactagggatgccttgtacgggttggttcatcaaaccacccggaatacgcccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 4012

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 4012
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on June 2003
Habitat soft sediment
Depth 60m
Location Scotland, Creag`s Hole
Latitude, Longitude 56.28, -5.3

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 4012 | taxon:1051367 | 2 | United Kingdom:Dunstaffnage | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttgcccttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaastagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttcttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 4012 | taxon:1051367 | 1 | United Kingdom:Dunstaffnage | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttgctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 4026

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 4026
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on June 2003
Habitat soft sediment
Location Antarctica, Ross Ice Shelf

Barcode sequences

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 2 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaattcgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggyttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgtgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggnttttaagtttnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcancatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcngaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 5 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgngtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttctttttatttttttaactttcaagtcttctggcttttcagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 4076

Species "monothalamids" > Clade C5 > Marsipella > Marsipella sp.
Isolate number 4076
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2002
Depth 60m
Location Mediterranean Sea, 3PP cave, France

Barcode sequence

SSU partial

>Marsipella sp. 4076 | genomic DNA | 4076 | taxon:1051378 | 1 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacgcactgaggattgacaggtgatatagatcttttcactttgtgtgattttttctaaataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaatggacttagaatttttatgtgtgatgctcgggcgttgtcgggtgtttgcttttttgcatttatcccttcatttctgcccttgtctttttttcacacgtctagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttaacttgattcctgatctctttctttctgactgagttcatttgcgtttcataacataagagtgctttcataaaactagagggaccgctgcgactttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattcatttattatctgactgctgctctttgagttttgcatcagataaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttttattattatgcactttctttttgatttgtgtatagtatgagcacacaatatgcggctcccctccctggtctttgattgcgattttaccgtctctcttggccattgtgtgtggggatggcctgtaattatgcaggcacttttacctttccgcatgtgctttttgtcaattcatggtggggacagaccattgtttatattctttttcttttatttgtaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacgaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatagtgcgatttgatctcacaacatctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 4643

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4643
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttattttcttataaaatatagttcacatataaatgatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataattttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaggtaatgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttgcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccg

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacctgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccaraggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcagtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgtttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccgcccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 4645

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4645
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4645 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgnc

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4645 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccaaagaccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaanccacccggaatacgtccctgccctttgtacacac

See sequence on NCBI

Specimen 4724

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4724
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4724 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggcctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgagtaccttagtaacttttgttgctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 478

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 478
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 478 | taxon:126667 | Agamont | Australia:Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatgtaatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatatttatattaatatatattataaagacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 483

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 483
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat soft sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 483 | genomic DNA | 483 | taxon:128074 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatatgttatgaatagttatttggataactaagggaaagtttggctaatacgtttaataataaatatacatataatattttaatgatagatattatataaattaaaaatacatttatttgtattttaaatagagtagactttatattattataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgattaatatataaccttgtattactgacttttattgaggcagtgacaagctgtaaagattaaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatatttaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttaattattttatatgttatcagaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatattattatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgctaatatattatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattttattactctcaactaattaattaaatatgattgagaagtaattctctctatttaaatattttatgagataaataattatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgatcaatatatattatattatataatatattattgtaatccttaaaattaaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 4836

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 4836
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Location Svalbard

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 4836 | J. Pawlowski 4836 (UniGE) | taxon:313611 | small subunit ribosomal RNA | sA-s6 region ctcaaagattaagccatgcaagtggttacactaacccgacagtttaaataagtgttcaatgctttttccacatatatgatatatacggtctattcgttcacacatacacacacacaccacccgtgctgaacttagattccaacatatatatatatacacacattaagtgaatcactgaattctcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcatacgcgcaatgcatgaatatatacattacgtttcgactattttcgtaattgctcctttcgcctatgcactttacatggtcttccgtgtcgagtgtatctgcaccgggggtattttgtgaaatgcgtcaaatgtattcctattgaaatgcaatgcacggcttacctacacacacacatacacacactgtgatttctctgtttcgcttatctttatttcaaagattgctacgcgttacaccgtgacaacttcttttatttatggataactcagggaaagtttggctaatacgtacgagtatttacacacacacacacacacactctcacacagtgtatatatatatatattggttggtgcatacattttctcacacatcgtgtgtgtattcaaacagtatgtatatatatatgactccctctactcagcactcaatggtagacttttggtttcacgctctgcgtattccagtacaagtttaatcgcaacatgagagacattgagcacgcacgtgatttcgttccctcgggaacttagtcacattcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattatatattgattattattatgcattatgcgcaaatttacaacatacattatgcaaatcattgtaacactacacacatacacaccctttttactctgtcatcatcatacatagcatatccttgttcgttgtttatttcagcattaaagcgtatatattattaacaccattatatacattcacttttttactgaggcagtgacaagctgtaacggttgagtatttaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttattctctgtaatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI

Specimen 4859

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4859
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4859 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttattttcttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctc

See sequence on NCBI

Specimen 489

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 489
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccataattatttggatttaaagtgaacatattatttatattattatataataaatgaatgcaacgaacgtgaccgtagccttttattgctattaataatttaaattatagcataaaattaaaggaaccgctgtcatttactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataattatatattttatataataaagtaacccatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatatttaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattatattatattataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 489 | genomic DNA | 489 | taxon:1032490 | Australia:Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatagatagtatagttatttaatatttggataactaagggaaagtttggctaatacgtttttaaatgtaaataatacattatgcatataataaatataatatatgataaatattatataaatattgatatacatttatttgtatattttaatgattgcagactttataatatttttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtaataataacttaataaatatatattatttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattttattagttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaaaacaatactgcgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctaattgawactgtatttcatgtttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaatcaaccaatatatatacatgtaatatataatataattgagtcattaatactgactcttatatttgaatatgttattcatttattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggattttcataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgnnnnnnnnnnnnnttgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccataattatttggatttaaagtgaacatattatttatattattatataataaatgaatgcaacgaacgtgaccgtagccttttattgctattaataatttaaattatagcataaaattaaaggaaccgctgtcatttactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataattatatattttatataataaagtaacccatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatatttaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattatattatattataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 494

Species Rotaliida > Nummulitidae > Operculina > Operculina ammonoides
Isolate number 494
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcattactatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatattttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaacaaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttcatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina ammonoides | genomic DNA | 494 | taxon:378197 | 5 | Australia | Aug-1997 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacatccatacagtgaatcactgaaatgtattacattacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctctatatatgcatggtacatgtatcatgtaatatatattctgtatacacacatacattgatttctctgtatcgcgcttatcttaataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatatcatttacatacacatacacctatcaatgtatctatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacatacagtgtgcagcatatataacacaattatatttactctgtcacccgacagtgtacatacatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgagtgaattctaattcattctgcgtttgatagttttttacgtgctacctttatacggttcgcgtatcgacgctacctaaaatgaaattattaccacgtatacggtttaccgtgctacagtaatatttcttatacacgcacactcgctcgctgtatcacacatacataacctactgcagcaactgagtgatcaatataccatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtgcatcgcacacacatacacacccgctgcacacagcgcttagtaagcttatattacgctatgtatataattcataacggttataaatgtcgatgggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcaggtgattatatattttctatcgcagtcacacacacatacatacacacttctgcagcagagatattatataacacttacagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctagtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgtaacataagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttgggcatttcatctgtcgtgttgtaattaaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcattactatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatattttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaacaaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttcatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 496

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 496
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis planatus | genomic DNA | 496 | taxon:128053 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaatagttataatccaaaatttggataactaagggaaagtttggctaatacgtttaatacgtaatacacatatatatattgcatattacgatatatcattattgcaacatgattgacgtaatataaatattataatacatttatttgtattaatatagagcagactttataatatttttataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgaataccttgtatacactatactcatatataatatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtataatttattatacattgcttgataatataccaatgttataaaatattggaatttgaatgcggtgattttaataatttcaagtacatggtataatatttattttaatattatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatatgtttacacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcayattaataaataattaattatttcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatgatatatattcccttcaatatacttaatacatttttatagttgagtatattattattatgtactcctatattaatatttgtgttttaatattgaatatttaattataatcataaatgattatatgtactttgcgctcataatatttaatcaggtgagatgtaagcattataggtgattaatatgcttatatatcatatgyatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 499

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 499
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatatttatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Marginopora vertebralis | genomic DNA | 499 | taxon:126667 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagtataatgttaataatagttatttataggataactaagggaaagtttggctaatacgttttaacagtattataattcttaatacacatataataatattataatatgataaatattatataaatattttaatacatttatttgtattaatatatagagttgactttataacatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttataataaaatatataatgtatatatattgaatactcaatatttatattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatattttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatgtaataatttcaagtaacatgtataaaatatttatattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaacatatataccaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctataatgaatattaatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattcacactaaacactaaacattataattataattatgattgagtatatgtcaaaatattactctcatattaaataattattatatatatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataaagtgaataatatacaagtaatattgtattattatgatctttaaaataaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatatttatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 500

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 500
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 500 | taxon:126667 | Gamont | Australia:Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataatattttaatattatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatacttatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 510

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 510
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 510 | marine sediment sample | taxon:128053 | 4 | Australia:Lizard Island | Sep-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagattattatatatttatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatgcattatatagtaatatataatttaatattgtgctgccttatatttatatataaggattttaagtgaacatattaatattgttttgctatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataattaatgttaattcattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatatcaactacacttaataagtgttaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatggtatatctatattatgtatatagtattttactattacataaataccattaactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacgtactatcagtacattgaaactcatacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 5127

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5127
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5127 | seawater, depth:4654m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tttgactcacgcgggaanncttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5149

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5149 | seawater, depth:2167m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5164

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5164
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5164 | seawater, depth:4407m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttctgtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5191

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5191
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5191 | seawater, depth:4803m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA atttgactcacgcgggaaancttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5222

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5222
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5222 | taxon:349561 | small subunit ribosomal RNA caagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttatacacactcacgcacacacaccatacgattttgtttacggtagtaacaatttcagcgtgaatcacttcttacacgcagtgaatcactggaatttacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcattttaaaaatttccttattcggaacacctgctcgcaggcttacgggtggatttttttatatcgacttttgtcgtgcatacccacgcatttcaaaattcattttgatttctctgtatcgcttattctctaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtacatataccacacacacacacacacgatacaaaatttattttgttttgctgcgtgtatcgacacaccacacacacacacacacacttactactcagcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttccttcgggagcttcacatcacgctgagcagactttgcgaagtttacttcgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatctatttataaattgtaacattaccatgcgttaacaatttacaacataacaagtttattacacatatagcactatatttttttctgtcacacagagaagacatccttgttcgttgtttattcagcatataagctattattttatattagttttttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaatttgaatgaattctcgtatccattctattttttgttatagttttacgcattatcaaattcacgtttgtattttgcgttcgacgctcgttaaaaatttacacacacacacttttttttttacgcggcactcgaatttttaccgtagcgtatatacgtacattctacacacacacacttatttacgtatatatgcactcacgcggtaattatttgagagaactatatcactcgcttaaaatttattctcctttcaacactgtgaacaaatcaaagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcacttccgccttaaagaaaattattgcaattttttcgccacacacacaccatgcgtacatgttatatatatttcgcagccacgtaaaattctgttattttctttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatgcgtataagagtcacacgtatatttttttacacacacacacacgcacaaaaattttatacgctctctctccattacgcatcaatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtatggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactgcccgcagcgtataccctcgggtatttcgtctgtcgtgtgcagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 523

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 523
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Bulimina marginata | genomic DNA | 523 | taxon:313259 | small subunit ribosomal RNA ttaccgggtccggcacactgaggattgacaggcaatattagcacttagcttcttgcgacgggttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaccaagggcctataattttacgtgtgttgcggcactttgacccctctttttttaaagagcgcgggtcttggttngcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgggcatatgnaattttttnaaattgctttgcgcgcaaaaaggntttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggnctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcaggagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctg

See sequence on NCBI

Specimen 5410

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5410
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2005
Depth 2462.4m
Location Arctic Ocean, AWI Hausgarten
Latitude, Longitude 79.3, 4.1

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagaatctatcaatacgtgcgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggttctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcacttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactgggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggatcgcggacgatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

SSU total

>Oridorsalis umbonatus | genomic DNA | 5410 | J. Pawlowski 5410 (UniGE) | taxon:331062 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttactccatcacgcacaacacatgattttgtttacagtagtaacaatttcagcgtgagtcacctcagcagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcaataaaaaatttcattcgacacctgttcgcgcaggcagacggtggatttttttattttgttgcatcacgcatacaaaatttttttgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtaatctacctcacacacacacacactcacgcacacaattcaaaaattattttgttttgccgtgtrtcgactatacatttcactactcagcactcaatggtaaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttcctttgggaacttcacatcgcgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtattttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacataacaagtttatcacacacacatataacactatattttttctgttacccatacagaattttctattctggacatccttgttcgttgttttattcagcataaataatatatctccaattttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgcttygtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnnngcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgaattctcatcattcagtttgaaagttttacgcgttggaatcaaatttatttgatttctcagcgcgttcgacgctgttaaaatttttacaatttacactgtattaattttttttaccaacggcacaaattttttctgccgcatatatttttactcacacacactcataacccacacaatatatgcatcacacgcgggaaatctttggaactcattcactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccttaaaaaaattttactgcattacgtgccgtacatatttttttatacacacacacgcatacgcacatgtttacatagccacgtaaaaatttttatcaacggtaatttttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattataatgtattcgcgctatttcttcacacacacacgcaaaaagttttagcgcacacagtacatattatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcttacaaaataacttggcttgagctcgtatttttatacgctcgcctaatttttttcgtatagtctcgatggacgtttcatttattattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcattgtgtcatactgcccgcagcgtatagtctcggctatttcgtctgtcgtgtgtagttgacaatcttgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagaatctatcaatacgtgcgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggttctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcacttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactgggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggatcgcggacgatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 607

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T9
Isolate number 607
Collector Jan Pawlowski
Identifier Maria Holzmann
Habitat salt marsh
Location USA, New York, Long Island

Barcode sequences

SSU partial

>Ammonia sp. 607 | genomic DNA | 607 | marine sediment | taxon:998794 | 13 | USA:Long Island, New York | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacattcatgcgntattatatcgtcggtgtaacgcaaataaatatgctagttctttcatgattatgtgataggtggtgcatgggccgttcttagttcgtggagtgatctgtcctgcttaattgcgtatcgtattaagtaggccatattatgtggggatcntctgcngccatngacccctcaacttcttagttgtagcgcgtgtcatgcgtacgatctcacttggccttatcgatagcaacngaacgtgaccgtattnctattgttgcagtgaaattcttaccactgcattgtgtgatacttttagtattgcacgtaaactantagagaccgctgtttctttcttaaaccagaggaaggttacggcaataacaggtctgtgatgccctcaaatgttccgggctgcacacgtgctacaatgatcattgcattgtgcatctaacccaatagtgtgtctagctcagcttacatgttgccttcgggtgatatgtaatgcgtgagcttggacgcctgaacctacttcgaaagtaaattttagtgggcaatctattagaagtaatgactcgcatttagaccaaaggcaacttatatgtacgcacatgcttagccggctcacctttgtgtgagtgcagtgcctaacatgttgttcgtacgcctatcgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgagtatgtaggactgtacgtgaccgtgaaaaatttatttttcactcaccatggaaatatacacgaatagtgtgatctannnnnnnaagagagaantcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 607 | genomic DNA | 607 | marine sediment | taxon:998794 | 15 | USA:Long Island, New York | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggantgacagacattcatgagttgttgcctcggcgcaactcatacaaatatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcgtattaagtaggccatatacgtgggatctctgcgccatgacccctcaacttctcagttgtagcgcgcgtcatacgtacgaatctcacttggcctatcgatagcaacgaacgtgaccgtattctattgttgcagtgaaattcttaccactgcattgtgtgatacttttagtgttgcacgtaaactatagagaccgctgtttctttcttaaaccagaggaaggttacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcattgtgcatctaacccaatagtgtgtctagctcagcttgcatgttgcttgcaatatgcaatgcgtgagcttggacgcctgaacctacttcgaaagtaaatnntagtgggcaatctattagaagtaatgactcgcatttcagaccaaaggcaacttatatgtacgcacatgcttagccggcttacctttgtgtgagtgcagtgcctaacatgttgtctcgtacgcctatcgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgagtatgtaggactgtacgtgaccgtgaaaaatttatttttcactcaccatggaaatatacacgaatagtgtgatctaaaggnannngaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. Ammp1 | genomic DNA | Ammp1 | taxon:155588 | 37 | true | USA:Long Island, New York | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctcaaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagtcgatgcaactttatacggagaccgatagcatacaagtaccgtaagggaaagatgaaaagcaccctattgagttcacgccgtcttagaaattatggcctcggccacttttcttatgacgcgcatacaactacagtgggagtgaaagagagagtgaaatcgcctatacgtgaaaatataaaatacacgcaacaacgtactgtattctatatagtctgcgatagtacaatcggacagagtgtggcattaacggccgtctgacttattctctcacactcagtgggtaagttatgattggcccatggttgatttttacaatcttccatacgcgacacaactgtacgacccgtcttgaaacacggaccaaggagttcaactggattacgagtcgtagcgttataatatataataagcgcatacggcatagcgaaagcaaacttatattactgtgccaggtcagccttaccgaggcttgtccgcagcacgcgctgagttagaatatacgtcggccgtaaggaaggcgtataccatataatttattatgtgggtaactcaagcgttcaacatcgagtacatcttgttgagacccgaaagatggtgaactatgcttggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctaagtataggggcgaaagactcatcgaaccatctagtagctggttccctccgaagtttccctcaggatagc

See sequence on NCBI

Specimen 6668

Archaias angulatus 6668
Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 6668
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat Reef sediment
Location Brazil, Maracajau Reef

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Archaias sp. 6668 MH-2008 | genomic DNA | 6668 | marine sediment sample | taxon:577497 | Brazil:Natal | 25-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatagaaaataataatagttatatttggataactaagggaaagtttggctaatacgttttttgtattaataatacatatgcatataataatattgcaacatgatagatattatataaataataaatagtatttatttagtatagagtggactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttatgttattattaaacttaatatattatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatgttttaattttatatgttattcgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatattatatataatatacaatactgtgaacaaaccagagtgtataaaacatgtaatatttttaattattagcaatgaatgttttatcatgggatattgctaatatatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctatnaagactaacaaaagcgaaggcacttaactagattattctctttntattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataaattattctctcaactaataattaaaaatgattgagtgtaattatttaatatactctcatttataattatacatgttgatattacacactatgattatatgtactttgggctcatataattatataggtgagatgtaagcattatagatgattaatatatttactacatattgtaaatattattataattctaaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggnagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 6733

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6733
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6733 | taxon:1051367 | 1 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgaaagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagctaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgtgggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6733 | taxon:1051367 | 7 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacagcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcaatgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6733 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgaaagcttgcattgtcaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggtatgctcttacgggagttttactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacagtttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6735

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6735
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6735 | taxon:1051367 | 5 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaatgctatgttttctgtgtttgctgttcggttttgctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatttttctacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcaaacgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6735 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttactgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgnaagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggtatgctcttacgggagttttactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcaggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccatttttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6735 | taxon:1051367 | 8 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cataccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6737

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6737
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcaaacgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 7 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgnttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcagcctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 8 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaattagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6795

Species Textulariida > Incertae sedis > Textularia > Textularia sagittula
Isolate number 6795
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Location Norway, Bergen

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttattaatttttattaataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattactttagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacaatatacgcgattaaatatttatttattttttcgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgctagcgcgtgtccaattatttgcgtacttttgtgcgtattttaattgtgtacattgtgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccttttatagcacacatatatacggcatctttacccggtttgcgcttgtcgtaaattttgtgtgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgtaaaatttattttttacagccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Textularia sagittula | genomic DNA | taxon:551666 | 18S ribosomal RNA tsagtttactcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctactaaaatttatacaacgcgcattgtttacagtagtaacaatttttagcgtgaatcccatcttaagtgattcatactgattatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacgataaaaatatattctttttacacgtttacgcgtaaaagattcattttttattaattttttgctaattacacacacacaaaattacacgcacaaaattaaaaattttgatttctctgtaacgctatctatataagattaattacgttacaccgtgaaaatttctttttggataactcagggaaagtttggctaatacgtacgagttttttttaacctacacacacacacacacacacaattacattcaaaattttttaatattttggtatgttacccctttactactcagcacatattggtaaattttggtttactttgtaaaccagtttaaaatttaactgcaacatgagagacaatatgtacgcacgtataattacttcggtatttatacattacgctgagcagactttgcgaagtttactttgcgaagcaggtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcgcgcatacggaagagtagtttctgatcccatagaaagagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttatatgtaattatactaatacacgcattacaatttacaataaacaaaattaatttaaattaattttagctattcattataacacttcaattttactgttaaaattttaaattatccttgttcgttgttactcgtatatttaatatataatattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgtctagttcgctaggcttggcagttcgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgtatggtgtttgtaaaatttcactatgcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacatatataaattaaatttattttaattttgtttgacaagttttacgcacataggtcactaaaaattattaatttttttttgactgttcgacgtgcgttcgacgctgttaaattttataaataaaattttattaattttttttttacacacacaattaattaaaaatttattaaaattttactgtttgccgtataaaatattttatttcaaacacttaaatttaatttacaatttcaacactgtgaacaaatcanagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatggaatgttgcacttttaattttaaaatttactgtattaaaaataatttttttacgcacacacacncacacgcacgtaaaaatatattttgacccacagagtcatgcattgatatataaaatttttattggtaaattttttaacagttaaaaatgtcgatggggatagttggagtcaggagtactgttgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcacttggctaggctatactctttgtgattaaataaaaaaaaaattaattattttaattttacgcacacacacacatacacgcacgtaaaatataataaattaaattttttatttatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacancaaacgatgggctctcaattgcatttatttattaaattgctaatgccctcagcctacaaaataatttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttaaacttttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcatactatccgcagcgtttatcttcggataatttgtctgtcgtgtatagttgacaatttttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtctgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttattaatttttattaataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattactttagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacaatatacgcgattaaatatttatttattttttcgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgctagcgcgtgtccaattatttgcgtacttttgtgcgtattttaattgtgtacattgtgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccttttatagcacacatatatacggcatctttacccggtttgcgcttgtcgtaaattttgtgtgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgtaaaatttattttttacagccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 6831

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6831
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2003
Habitat soft sediment
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.14

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 6831 | taxon:1051367 | 1 | Norway:Bergen | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacgcggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcaggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttcttgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6832

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6832
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2003
Habitat soft sediment
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.14

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 6832 | taxon:1051367 | 5 | Norway:Bergen | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcactgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgtcgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcaggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaagggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6833

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6833
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2003
Habitat soft sediment
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.14

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 6833 | taxon:1051367 | 4 | Norway:Bergen | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatattttcctacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggatttgttttaaagcttcggcagagaagcaggttcttttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagtcaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcnttcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6844

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6844
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2003
Habitat soft sediment
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.11

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 6844 | taxon:1051367 | 7 | Norway:Bergen | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaaggggggcttgttttaaagctttcgggtggagaagcaggttcttttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattaaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6845

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6845
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2003
Habitat soft sediment
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.11

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 6845 | taxon:1051367 | 2 | Norway:Bergen | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcatcgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaaggggatttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttgacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6929

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 6929
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P6929-22 | taxon:349561 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcgtgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtagagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P6929-21 | taxon:349561 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccatatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 71

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 71
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1995
Habitat soft sediment
Location Puerto Rico, Isla Magueyes

Barcode sequence

SSU partial

>Archaias sp. 71 MH-2008 | genomic DNA | 71 | marine sediment sample | taxon:577506 | 1 | Puerto Rico | Apr-1995 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 7180

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7180
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7180-12 | taxon:349561 | small subunit ribosomal RNA taatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtct

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7180-11 | taxon:349561 | small subunit ribosomal RNA aatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacggacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgnacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcgtacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaac

See sequence on NCBI

Specimen 72

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 72
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1995
Habitat soft sediment
Location Puerto Rico, Isla Magueyes

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 72 | taxon:46130 | Puerto Rico | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattcatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacatatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 7565

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7565
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 1990m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.49, 137.08

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7565-21 | taxon:349561 | small subunit ribosomal RNA tcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcgtgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaac

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7565-22 | taxon:349561 | small subunit ribosomal RNA aacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggcggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttnttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgnggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 7566

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7566
Collector Jan Pawlowski
Identifier Jan Pawlowski
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7566-33 | taxon:349561 | small subunit ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaagtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaag

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7566-31 | taxon:349561 | small subunit ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgtttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacanngnggtctaaaggaaagagnagtcgtaacaaggc

See sequence on NCBI

Specimen 7763

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7763
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 20m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1, -58.37

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7763 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.37 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtngcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattrttgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactggctttctatttat

See sequence on NCBI

Specimen 7776

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7776
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Location Antarctica, King George Island, Admiralty Bay

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7776.3 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtctagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagttatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7776.2 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggtacagacattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7784

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7784
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1667, -58.4167

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7784 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatnagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7790

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7790
Collector Jan Pawlowski
Identifier Jan Pawlowski
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1667, -58.32

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7790 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7855

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7855
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7855 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggcttttaagttnnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7856

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7856
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7856 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttatttttttaactttcaagtcttctggcttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttnctttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7866

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7866
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7866 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttattttttaactttcaagtcttctggcttttaagtttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7887

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7887
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 107m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7887.1 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.34 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaagtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctttatgagtttgggggactggctttctatttatagncagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 7902

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7902
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7902 | taxon:1051365 | 15 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccctgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7905

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7905
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7905 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcnnttcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgaacaaggcaa

See sequence on NCBI

Specimen 7907

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7907
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7907 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaatcgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7907 | taxon:1051365 | 28 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcctaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccaatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7909

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7909
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7909 | taxon:1051365 | 31 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggtccaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7909 | taxon:1051365 | 33 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtacgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgwacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7918

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7918
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1, -58.32

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7918 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.06 S 58.19 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7931

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7931
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Location Antarctica, King George Island, Admiralty Bay

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7931 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7962

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7962
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 21 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgcgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 23 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatataattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcaataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7963

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7963
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7963 | taxon:1051365 | 39 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctctgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7964

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7964
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7964 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaanagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttanatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8010

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8010
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 108m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.29

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8010 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.29 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 8149

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.04, -58.21

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8149 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.04 S 58.21 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctngtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 9264

Species "monothalamids" > Clade CX > Shinkaiya > Shinkaiya lindsayi
Isolate number 9264
Collector Jan Pawlowski
Identifier Beatrice Lecroq
Habitat soft sediment
Depth 5435m
Location Japan Trench off Sanriku
Latitude, Longitude 38.14, 147.0

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggatatactgaagattgacaggaaataatgattagtttttaaactcttacatttaatttgctggtcctttcataatagtatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgtgtaggacttaatactcaacagtgtgctactttacaatacccttggttgttgtgaaatttatctgtagtgagggttttcgcatattgatatattttttgagtaagtacatcttaagccctgaacgcaacgaacgtgaccgcaaccctttgtaactaccttttggaaaattgcgcctggatttttttcaggtttttgtgattagctaacttaggggactgctgcgatttcttttaaaccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcacctcatttaataaaactgatcataagatcgaaagattttttattggtcagaatgggcctgcctcgaaagagtgtaggtaatcaatacgaagtaatgatttctctgattacaaattttatttgtttttgatagcacacaatatgctaacgctatatctctgaatattagtaaaaatattttttgttgacttttttgtttaaagtggcaaatttatatttttgaaatttggtgtgttatagttttttagtatgtgctttttgtcaactcttggtggggacagaccattgtaaattgttggtctcgtcttaactaggaatgccttgtacgggttttggtttaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttaagggactaatatgatttcattatagaaacttaaacgaacagtgcggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Shinkaiya lindsayi | genomic DNA | taxon:525825 | small subunit ribosomal RNA ctcaaagattaagccaagcaagtggctatgataacccaacagtttaaataagtgattatttattcgaattttttaaagttttgttttacaaagcgtttattcatttatgcaactgcaaacagctgcttaatatagttacacttgtcttgacttggcgttcatatttgtataattttttatattgatattagatattaatttgatttctctgtaacattttttattgttataattttaaatttttaaaagttttggataactcagggaaagtttggctaatacgtacgagaattaatatttttgatattcataattatgtttttttggtgtatatttttttaaagtatatttttgtgttgttaaatattttgattgtgatattttctatataatactgtgattattttttgtctttaaatttgtttgaggagacaaattaatttgattattgataaagatttaggtattaatggtcgacacctaggattttattagttttagctgtcgagcatttgtgataatctttgttttttaatttttaaagattcaaacattcaaatagttttaagaaataagaaatatgtatttctagattgttgtaaataatatcgtgtgtaatcataaatatatgaaatataatttaatataaaatatagtttgatctgaattgatattcggattttttgttgttaataattgtggattttttatgtcttcagcacttatcggtaaatttttattgaaatttaatagctacgtgaaatgacgataagtacgcgtgtatttaatatgtgtttacatatattgattacaacattgctgagcagactttgcgaagtgaaaatctaagcgaagcatgtcatacaagcatctagagcatcaagtcaccgggttggcaagtgtatttttgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcaaagtccattgagagatcgctcttagttctaaggaacgcagcaggcgcgtaatttgcccaatgctagtaccctattattattagtattgtattgtaatttttttgtgataacgtatatgcatatgcgttattactagtgttaatgattttatccttgttttctatgtcgatgtaattataatataatttttttagttatttactgaggcagtgacaagctgtaatggttgagtataaataagacaaacgtataaattccaatcttgtttttagcaagttatttaacttttgcgttttgtgtactcaattagaatgcggtgagtttaaacaactcagaacctttaaatggtattagagattatctttagctatttatgtatctgaatttcaagtggagggaaagtctggtgccagcagccgcggtaataccagctccactagcctatacaattattgttgcggttaagaggctcgtagttggattgaacaaaattttaattttacggtaaacaagatttatgatttattttagtaaatcattttttgttataattgagtttgattgtattgtggtttgtcactaatctttaaatttgattatttatgttatatattttaaatcattttttgttataattgagtttgattgtattgtggtttgtcactaatctttaaatttgattatttatgttatatatttcaacactgtgaacaaatcagagtgcatcaaacatgtngtaaaagtgcaatgcatgaattatcatggaatgttgcatgttattagatgttttttggtgttttttaaatattatgaggagtggtacactagaaagtaagattgtcaaatgtaatttttttattttgtgtatatgaatctgtaagtttttttatgtgagtaaggttgtatgatatgatgtacgatttatatttaattgtaaggctttttgcttgctaaacagaattatatggagtaatatgtttgccgaaaccgtgaaagtaagccatagcgtgaaggtaatcattgaaatatgagtattcatttgaaaatgagctttattactatatacatttttttntggagtaaggttgtatgatatgatatgatatgtgataaatataatgtatgatacgatgtacaataaatataatcgtaaggctttttgcttaataaacagaattatatggagtaacatgcttgccgaaaccgtgaacgtaagccatagcgtgaaggctttattactataaatatttttttctggagtaatgttgtattatatgatctgtgatgaatatgattgcgtggtttttgcttgataaaagaattgtgtacgagtaaggctgtattatattatatacaataaacagaattgctaaaatattttaaaaatattnaaaatatctatgtcgatggggatagttggagtcaagagtactgcttggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcgcttgactaggctatactctttgtgttgtttttgattttatatattttatatttcatctaaatttcactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcataagcattaagttgtttttgccctcaatctgcaaaatatttggtttgagcttgtgttaagtttaacacgctcactatttttcgtatggtttcgaaggacatttcatttatataatttcgttgcgtgtaagtattataatattacttgaaatattagtaatatgtgtctacacatgattgtttgagctttgcgctcatattattggtgagatgtaagcactagatgaacgtttgctgaatataagcagaaagttttttgttttttgttctagtataacttttgtcatgtataaagtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaattcgcccttacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggatatactgaagattgacaggaaataatgattagtttttaaactcttacatttaatttgctggtcctttcataatagtatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgtgtaggacttaatactcaacagtgtgctactttacaatacccttggttgttgtgaaatttatctgtagtgagggttttcgcatattgatatattttttgagtaagtacatcttaagccctgaacgcaacgaacgtgaccgcaaccctttgtaactaccttttggaaaattgcgcctggatttttttcaggtttttgtgattagctaacttaggggactgctgcgatttcttttaaaccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcacctcatttaataaaactgatcataagatcgaaagattttttattggtcagaatgggcctgcctcgaaagagtgtaggtaatcaatacgaagtaatgatttctctgattacaaattttatttgtttttgatagcacacaatatgctaacgctatatctctgaatattagtaaaaatattttttgttgacttttttgtttaaagtggcaaatttatatttttgaaatttggtgtgttatagttttttagtatgtgctttttgtcaactcttggtggggacagaccattgtaaattgttggtctcgtcttaactaggaatgccttgtacgggttttggtttaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttaagggactaatatgatttcattatagaaacttaaacgaacagtgcggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen D18

E. aculeatum D18 E. aculeatum D18
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D18
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D18.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgmagtggttatttaacccgacagtttaactaagtgttattaacgtcaatagattactaatctatacaacccacgtaacagtgaatgcacatttcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattgctatattcacgcttaatgcgcgaatcggcactacacaacacatacttgcttacgataataattatattattatcgggtaatacgtgatttcttcactgagaagctattgcattactgcagtacgcttatcataccattacaacacatcttatggataactcagggaaagtttggctaatacgtacgagtcacattacttcacacagcaattgttattcgcaatctgtcgcgtctaccgcattcatgaaacaaacattaattataaatgcgcgcgcgcactcatctgcgaaataactaaactaattactcagcactcaatggtaaacttatgcgtctgcgtacttctgtcttcggacgatgcgcttacgcatgattcgtttaactgcaacatgagagacattgagcacgcagtctttcgatccttcgtgattgattgacatctacgctgagcagactttaagattcttaatcttgaagcatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatatggcgtgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D18.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA tatttaacccgacagtttaactaagtgttattaacatcaatagattactaatctatacaacccacgtaacagtgaatgcacatttcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattgctatattcacgcttaatgcgcgaatcggcactacacaacacatacttgcttacgataataattatattattatcgggtaatacgtgatttcttcactgagaagctattgcattactgcagtacgcttatcacaccattacaacacatcttatggataactcagggaaagtttggctaatacgtacgagtcacattacttcacacagcaattgttattcgcaatctgtcgcgtctaccgcattcatgaaacaaacattaattataaatgcgcgcgcgcgcactcatctgcgaaataactaaactaattactcagcactcaatggtaaacttatgcgtctgcgtacttctgtcttcggacgatgcgcttacgcatgattcgtttaactgcaacatgagagacattgagcacgcagtctttcgatccttcgtgattgattgacatctacgctgagcagactttaagattcttaatcttgaagcatgtcatacaagcatctatagcaccaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatattttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagtggtgaaatgcattgacccttgcaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen D3

E. aculeatum D3 E. aculeatum D3
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D3
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D3.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagcatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtagttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagcaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.3 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggctattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagagagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaatgttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI