Specimens collected by “Bruce Hayward” (5)

Specimen 108

Ammonia sp. T5_108, spiral view Ammonia sp. T5_108, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aoteana T5
Isolate number 108
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on March 2000
Habitat salt marsh
Location New Zealand, Pollen Island

Barcode sequences

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 13 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnnnnggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgcttcggcaacaaacccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcctttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctctcacgctctcgcgcggaagcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 3 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcngtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgccctcgcgctaacaaaccccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctattcgctctcgggcggaagcttagtggaaatatatatggatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 108 | genomic DNA | 108 | taxon:155798 | 7 | single cell | true | New Zealand:Pollen Island | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaacaaaatacatgtgcctcgcgcgcatgatttagcccgtcgatactatcctagcatattaccggtctcggccggtaactcaatatgcgggaattgtagcatcgtaataataaaaaaaatatatatgtgcacgcacacacacacacacccaccgcgtacgtacttgtaaacacacagcgtctccgcgttggaaagcaagtttatatcctctttggatatgccatagagtgtgacagccacgtttcactcataaccgtacgcacacacacacgccccgtgcactaatatatatttctataacctgagtcgagttattt

See sequence on NCBI

Specimen 132

Ammonia aomoriensis T6_132, spiral view Ammonia aomoriensis T6_132, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aomoriensis T6
Isolate number 132
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on June 2000
Habitat salt marsh
Location China, Yalu Jiang

Barcode sequences

SSU partial
SSU partial

Other sequence

LSU partial

>Ammonia sp. 132 | genomic DNA | 132 | taxon:155816 | 8 | single cell | true | China:Yalu Jiang | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatatatttatgcgtctctggcgcatatttttagcccgtcgatactatcctagcgtattaccggtttcggccggtagcccaatacgcgggaattgtagcatcgtaataaaatatacaccatgcctgcgtcgcaaacgtatatacacgtatactcacacacacatactcgtacgcgtacacaccccttgcaaacacacagcgctcccgcgttggaaagcaagtctatatcctctttggatatgccatagagtgtgacagccacgtttgaaacaccctacgtaccgtacacacacacatacgtaaaaatacgcgctgcttcgcatacgcataccgtatataacctgagtcgagttattt

See sequence on NCBI

Specimen 175

Ammonia sp. T10_175, umbilical view Ammonia sp. T10_175, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T10
Isolate number 175
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on September 2000
Habitat salt marsh
Location USA, Washington State, Grays Harbour

Barcode sequences

SSU partial

>Ammonia sp. 175 | genomic DNA | 175 | marine sediment | taxon:155833 | 3 | true | USA:Grays Harbour | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggnnnnnnnnnnctcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtactctcgcgggtactatggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctccctcgcggaggcgtgtgtcgcacgtacgctatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttgtgcgtactaccactgcttagcgcgtgacacacttcggtgtgcccgcgcattaaactatagagaccgctgtttctcctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagtgcgtatgctcttcggagtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacacctttatgtgcgcgcgggctaaccgttctggtctctgtatcagttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccgaagttgcaccgtctcggcggcgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 175 | genomic DNA | 175 | marine sediment | taxon:155833 | 4 | true | USA:Grays Harbour | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggctnaannngactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtactctcgggtactatggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctctttaccgaggcgtgtgtcgcacgtacgctatgcgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttgtgcgtactaccactgcttagcatatatcgtgcctcgtgtatgattatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaatagcaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagtgcgtatactttcgggtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgctttagaccttggcacaccatatgtgcgcgcgggctaaccgttctggtctctgtaccagttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcgccgctcgcggtgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 175 | genomic DNA | 175 | taxon:155833 | 41 | single cell | true | USA:Grays Harbour | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataacacatatacgcgtcgttcgcgacgtgtatctttagcccgtcgatactatcctagcgtatgactctctgtctcggcagagtgtcgcctaatacgcgggaattgtagcatcgcaataaataatatacgtatatacgcgccacacacacataccaactcagtgccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcttcggatatgccatagagtgtgacagccacgtttggaacaccactcggcaactgatacacgcgcataatacataccgtatataacctgagtaaagttattt

See sequence on NCBI

Specimen 176

Ammonia sp. T10_176, spiral view Ammonia sp. T10_176, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T10
Isolate number 176
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on September 2000
Habitat salt marsh
Location USA, Washington State, Grays Harbour

Barcode sequences

SSU partial

>Ammonia sp. 176 | genomic DNA | 176 | marine sediment | taxon:155834 | 4 | true | USA:Grays Harbour, Washington State | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtgctctcgggcactgtggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctctttacgaggcgtgtgtcgcacgtacgctatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttggtgcgtactaccactgcttaggcgtgacacacttcggggggcccgcgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagcgcgtatgctcttcggagtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacacctttatgtgcgcgcgggctaaccgttccaacctctgtgttggttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgcaggactgccaaagcgccgcttgcggtgcttagtggaaatatatatgaatagtgtgatctaagggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

Other sequence

LSU partial

>Ammonia sp. 176 | genomic DNA | 176 | taxon:155834 | 44 | single cell | true | USA:Grays Harbour | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataacacatatacgcgtcgttcgcgacgtgtatctttagcccgtcgatactatcctagcgtatgactctctgtctcggcagagtgtcgcctaatacgcgggaattgtagcatcgtaataaataatatacgtatatacgcgccacacacacataccaactcagtgccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcttcggatatgccatagagtgtgacagccacgtttggaacaccactcggcaactgatacacgcgcataatacataccgtatataacctgagtaaagttattt

See sequence on NCBI

Specimen 729

Ammonia sp. T12_729, umbilical view Ammonia sp. T12_729, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T12
Isolate number 729
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on December 2001
Habitat Marine salinity mangroves
Location New Caledonia, Titi Beach

Barcode sequences

SSU partial

>Ammonia sp. 729 | genomic DNA | 729 | marine sediment | taxon:190122 | 4 | true | New Caledonia:Titi Beach | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcatgcggtttctgttcgcagttaacccatgcttaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcactttattgcgaggcgcgtgtcgcacattcgttatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtttgcctcggcaacgacccactgcttagtatgcgttggttgcgccttcgggcaaaaactaaacgacatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcggtatgtattatttcgcttcggcgtgtgatacatatttgtttcgtgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgttgtagcctgcctgtttcgtacgtgcccatccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctgcattgcgttcgcgcatcgcacttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 729 | genomic DNA | 729 | marine sediment | taxon:190122 | 5 | true | New Caledonia:Titi Beach | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcatagaggtttatacccctatgcttaaagatgctagctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcactttattgtgaggcgcgtgtcgcacattcgttatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtttgcctcggcaacgaccccactgcttagtatgcgttaggttgagccttcgggcaaaaactaaacgacatacattaaactatagagaccgctgtttcctctttaaaccagaggaaggatacggcaataacaggtctgtgatgctctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcggtatgtactatttcgcttcggcgtgtgatacatatttgtttcgtgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgttgtagcctgtctgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctattaccgatggattatactatgaatctataggactgccaaagctgcattgcgttcgcncatcgcacttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 729 | genomic DNA | 729 | taxon:190122 | 3 | true | New Caledonia: Tieti Beach | large subunit ribosomal RNA | contains divergent D1 domain and conserved domains C1 and C2 cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataataccaactatgcgcttcggcgcataattttagcccgtcgatactatcctagcatatcaccggtctcggccggtaactcaatatgcgggaattgtagcatcgtaataagaaaaaatataacaatatataataatacgccacgcacacacacacatacacaccgcgtctctgcgtacaacttgtaacaaacacacagcgtctccgcgttggaaagcaagtttatatcctctttggatatgccatagagtgtgacagccacgtttgactcactcacaagtacgcattcacatatactcacggcgcaccgtgccatggctgtatcaatatttatatatatatatatttttctataacctgagtcnagttattt

See sequence on NCBI