Specimens collected by “Tomas Cedhagen” (10)

Specimen 1370

Species "monothalamids" > Clade C1 > Toxisarcon > Toxisarcon synsuicidica
Isolate number 1370
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on April 1999
Habitat soft sediment
Location Sweden, Kosterfjorden, Yttre Vattenholmen

Barcode sequences

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | Sweden:Kosterfjord | 16S rRNA | 16S rRNA | 16S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | 1 | Sweden:Kosterfjorden, Yttre Vattenholmen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5174

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5174
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4526m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -70.31, -14.34

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccctagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtcttttgtgagcctkgtatttctttttttagtttatacatctcagttngnctkcgttttatgggagtgtgtttgtctttttatatttattccgcttttngcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgntaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtcyaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 3 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggkgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccacatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 5226

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5226
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5226 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacraacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 559

Ammonia sp. T3_559, umbilical view Ammonia sp. T3_559, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia batava T3
Isolate number 559
Collector Tomas Cedhagen
Identifier Maria Holzmann
Collected on September 1997
Habitat soft sediment
Location Sweden, Tjärnö

Barcode sequences

SSU partial

>Ammonia sp. 559 | genomic DNA | 559 | marine sediment | taxon:998792 | 4 | Sweden:Tjaerno, Koesterfjorden | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttgctctcgagcacgtggctcaaagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtgtacgcgtattactcatgtggtagtgacccccttctcacggaggcgcgtgtcgcacatatggtatacgcaccggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaattatacgtgtgctttatgcatacattcccactgcttagtgtgcgtatcagtacttgtactgtgcgtcacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcactgcactgtgcatctaacccaatgtgcgcggacgccacgatgtgtaattgccttcgggcattttatatattcgcttgtgcgactgcgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtgggggtagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctttgcggcgtgttcgcacaccgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 559 | genomic DNA | 559 | marine sediment | taxon:998792 | 5 | Sweden:Tjaerno, Koesterfjorden | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttgctctcgagcncgtggctcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagngatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtattactcatgtggtagtgacccccttctcacggaggcgcgtgtcgcacatatggtatacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaattatacgtgtgctttatgcatacattcccactgcttagtgtgcgtatcagtacttgtactgtgcgtcacacattaaactatagagaccgctgtttcttctttaaaccaaaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccacgatatgtatttgccttcgggcattttatatattcgcttgtgcgactgcgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgccttcgtgtgagtgcagtgcgtagcttgctgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctttgcgcgtgttcgcacaccgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. AS2 | genomic DNA | AS2 | taxon:155587 | 43 | true | Sweden:Tjaerno, Koesterfjorden | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctctaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagtcgatgcatattgcggagaccgatagcatacaagtaccgtaagggaacgatgaaaagcaccctattgagttcacggcgcagacttgcttcggttcgccgttgcttgtcccgcgcccaacaactacagtgggagtgaaagagagagtgaaatcgcctatacataaacaaatatactatatgcacacacacacacagtgtaattgcatacagcatacacacagtctgcgttagtacaatcggacagagtgtcgtataactttatatggccgcctaatatacgcacacacacaatgtattttatggtctggctcatagccggtttcgaccgctatacgcgacacaactgtacgacccgttttgaaacacggaccaaggagttcaactggattacgagtcgtagagtaacatgtatctatatacaactatatttacactcacacggcatagcgaaagcaacttaatcctttactgtgctaggtcggccctcaaaagctgaccgcagcacgcgctgagtgtgtatatacgtgagggccttagtgtcaacgcgtatacctgtcacagcttcggctgctaacaggatcactcaagcgttcaacgagtatatcttgttgagacccgaaagatggtgaactatgctcggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctgagtataggggcgaaagactcaacgaaccatctagtagctggttccctccgaagtttccctcaggatagc

See sequence on NCBI

Specimen 560

Ammonia sp. T3_560, spiral view Ammonia sp. T3_560, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia batava T3
Isolate number 560
Collector Tomas Cedhagen
Identifier Maria Holzmann
Collected on September 1997
Habitat soft sediment
Location Sweden, Tjärnö

Barcode sequences

SSU partial
SSU partial

Other sequences

LSU partial

>Ammonia batavus | genomic DNA | AS 3 (Tjarno Fjord, Sweden) | taxon:75326 | 3 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactctgtgcataatttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacacaaatatatacgcacacacacacacacatatgcctcacgcctcatagcacgtactgacatatcttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcatatatgcagtacacgcaactcacacacatacacggcgcggcgtgtcgtgcacacacaatatatatttatataacctgagtcgagttattt

See sequence on NCBI

LSU partial

>Ammonia batavus | genomic DNA | AS 3 (Tjarno Fjord, Sweden) | taxon:75326 | 2 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatacgcactctgtgcataatttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacacaaatatatacgcacacacacacacacatatgcctcacgcctcatagcacgtactgacatatcttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcatatatgcagtacacgcaactcacacacatacacggcgcggcgtgtcgtgcacacacaatatatatttatataacctgagtcgagttattt

See sequence on NCBI

Specimen 8352

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8352
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 4 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtccttttgagcttgtattgctttttctagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattagtgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagtttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgcgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggagtgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtctgagggactgggttgcagttttttttatattctgcaaacacctgcggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8353

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8353
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 9 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggkggkgcatggccgttcttagttcgkggagkgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcgcacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttataaatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgnacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 8 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatctttccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8356

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8356
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 16 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtatacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttatttcttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttatgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 15 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8357

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8357
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8357 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 22 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8360

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8360
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 30 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacncttctcataacatangaggntttccnaaanctnnngggnncgctgcgacttttttaaaccagaggaaggttgnggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatngcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacnagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattgnaagtaatgatttccctttctctttttttattacatatatatttttttgnganttctttaattaagcnagcacannatatgtctnntctcncgccctgnctgnngnnntttgtagttttntttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttagaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctttggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 29 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacattgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI