Specimens identified by “Tomas Cedhagen” (8)

Specimen 1370

Species "monothalamids" > Clade C1 > Toxisarcon > Toxisarcon synsuicidica
Isolate number 1370
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on April 1999
Habitat soft sediment
Location Sweden, Kosterfjorden, Yttre Vattenholmen

Barcode sequences

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | Sweden:Kosterfjord | 16S rRNA | 16S rRNA | 16S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | 1 | Sweden:Kosterfjorden, Yttre Vattenholmen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5174

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5174
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4526m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -70.31, -14.34

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccctagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtcttttgtgagcctkgtatttctttttttagtttatacatctcagttngnctkcgttttatgggagtgtgtttgtctttttatatttattccgcttttngcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgntaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtcyaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 3 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggkgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccacatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 5226

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5226
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5226 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacraacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8352

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8352
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 4 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtccttttgagcttgtattgctttttctagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattagtgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagtttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgcgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggagtgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtctgagggactgggttgcagttttttttatattctgcaaacacctgcggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8353

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8353
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 9 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggkggkgcatggccgttcttagttcgkggagkgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcgcacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttataaatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgnacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 8 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatctttccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8356

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8356
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 16 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtatacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttatttcttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttatgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 15 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8357

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8357
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8357 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 22 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8360

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8360
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 30 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacncttctcataacatangaggntttccnaaanctnnngggnncgctgcgacttttttaaaccagaggaaggttgnggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatngcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacnagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattgnaagtaatgatttccctttctctttttttattacatatatatttttttgnganttctttaattaagcnagcacannatatgtctnntctcncgccctgnctgnngnnntttgtagttttntttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttagaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctttggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 29 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacattgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI