Specimens collected by “Susan Goldstein” (2)

Specimen 464

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T7
Isolate number 464
Collector Susan Goldstein
Identifier Maria Holzmann
Collected on December 1995
Habitat salt marsh
Location USA, Georgia, Sapelo Island

Barcode sequences

SSU partial

>Ammonia sp. 464 | genomic DNA | 464 | marine sediment | taxon:998790 | 16 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcatagttcgctgtnncntagntganagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctctccgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttctggtcccttgtaccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcgacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggcaaag

See sequence on NCBI

SSU partial

>Ammonia sp. 464 | genomic DNA | 464 | marine sediment | taxon:998790 | 17 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcgctgcgcatagctgaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctcctcgcgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagggcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgctttagaccttggcacaatatatgtgcgcgcgggctaaccgttgtaacctctgtgttacttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 465

Ammonia sp. T7_465, spiral view Ammonia sp. T7_465, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T7
Isolate number 465
Collector Susan Goldstein
Identifier Maria Holzmann
Collected on December 1995
Habitat salt marsh
Location USA, Georgia, Sapelo Island

Barcode sequences

SSU partial

>Ammonia sp. 465 | genomic DNA | 465 | marine sediment | taxon:998791 | 1 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatattcatgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactgggtctccgatagcaaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcggctatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttgtaacctctgtgttacttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 465 | genomic DNA | 465 | marine sediment | taxon:998791 | 2 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcatagttcgctgtnncntagntganagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctctccgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcgggtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttctggtctcttgtaccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequences

LSU partial

>Ammonia sp. | genomic DNA | Amm GS 2 (from Georgia, USA) | taxon:43993 | 1 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataacagagactaaccaggattcccttagtaacggcgagtgaactgggataccaacaatatatatatacgcttcactgcgtgtatatctttagcccgtcgatactatcctagcgtatgacttatactgtctcggcagttggtcaccaaatacgcgggaattgtagcatcgtaacacatatatacactataagcagcgcacacgtatatacacacacatatacacgtataccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcctcggatatgccatagagtgtgacagccacgtttggaacacccttataccggtacacacacatacactcactgcgcatatacgcttagcacgatatataacctgagtcgagttattt

See sequence on NCBI

LSU partial

>Ammonia sp. | genomic DNA | Amm GS 2 (from Georgia, USA) | taxon:43993 | 3 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatatatattatatacgcttcatgcgtgtatactttagcccgtcgatactatcctagcgtatgacttatactgtctcggcagttggtcaccaaatacgcgggaattgtagcatcgtaacacatatatacactataagcagcgcacacgtatattatacacacacatacgtatataccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcctcggatatgccatagagtgtgacagccacgtttggaacacccttataccggtatacacacacatatacactgcgcatacgcttagcacgtatatataacctgagtcgagttattt

See sequence on NCBI