Specimens collected by “Susan Richardson” (1)

Specimen 2270

Species "monothalamids" > Clade CX > Syringammina > Syringammina corbicula
Isolate number 2270
Collector Susan Richardson
Identifier Susan Richardson
Collected on May 2000
Habitat soft sediment
Depth 3106m
Location Atlantic Ocean, off Cape Verde
Latitude, Longitude 18.27, -21.01

Barcode sequence

SSU partial

>Syringammina corbicula | genomic DNA | 2270 | taxon:212475 | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaatcatgtgaaatgtttctaacttttacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacataggacttaaactcaagtgtgctacatttcttgtacttattatatgtaaatttgatataatatatatatgtgttataaaaatgattgtaatataaaatttactttttatataattttcattaagtatatataatatttttacaattattactaaatatttactattttgaaattgtacgtacacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttactaaaacgagtatcttaaaaattaatattttttattaataaattatctacaagttttgaccagaaagtgctttatcaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcattttataatgctgtatcatcatcaatctttttaaaagttacttgatttagttgaacagtaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttctcttaattcaatattgtttgattttgtgagcacacaatatgctgctcctttccctggcagttagcttttttggtctttctgtctttcagtgagttaggatgtttctcagcatgtgctttttgtcaattcttggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgagtaccttgcttttttgaagttattaccacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI