Specimens identified by “Frédéric Sinniger” (4)

Specimen 4026

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 4026
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on June 2003
Habitat soft sediment
Location Antarctica, Ross Ice Shelf

Barcode sequences

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 2 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaattcgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggyttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgtgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggnttttaagtttnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcancatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcngaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 5 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgngtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttctttttatttttttaactttcaagtcttctggcttttcagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7855

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7855
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7855 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggcttttaagttnnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7856

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7856
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7856 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttatttttttaactttcaagtcttctggcttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttnctttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7866

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7866
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7866 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttattttttaactttcaagtcttctggcttttaagtttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI