Specimens collected by “Delia Fontaine” (15)

Specimen 6200

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6200
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 3 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 6201

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6201
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6201 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcacgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatatttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6201 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgcgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttgattcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 6205

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6205
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6205 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA gacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttccgcgtgaatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgccctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatctataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgcggacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6205 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaaatttattctgcacacctatggaaacttaaacgaacagtgtgtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgatcctg

See sequence on NCBI

Specimen 6206

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6206
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequence

SSU partial

>Cibicidoides variabilis | genomic DNA | 6206 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaaggatca

See sequence on NCBI

Specimen 6473

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6473
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6473 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgagacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacatttttttctacacacacacacacacactcacaattatttttgtrtcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatt

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6473 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA ggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI

Specimen 6474

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6474
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6474 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgagacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacattttttctacacacacacaccacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaa

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6474 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA atgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacga

See sequence on NCBI

Specimen 6476

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6476
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6476 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgagacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacattttttctacacacacacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatc

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6476 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA gagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacgcaggaatttatttctgcacccctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcat

See sequence on NCBI

Specimen 6479

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6479
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6479 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA taacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgaaacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacatttttttctacacacacacacacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatctttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatc

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6479 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA gagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacccaggatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI

Specimen 6480

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6480
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6480 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA ttaaataagtgttaaatgctaccattaaacttatatatatacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacacatggttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgaracacccgttcacgcgggcagatcggtgatcatttttgttttgttggattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacatttttttctacacacacacacacacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagta

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6480 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA ggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtccgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttacctaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI

Specimen 6481

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6481
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequence

SSU partial

>Cibicidoides dispars | genomic DNA | 6481 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI

Specimen 6483

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6483
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6483 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aataagtgttaaatgctaccattaaacttataatatatcaggcatagagcgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagamagctgcttaatamagtcacacttgtcttgacttggmgcaataaaaattttcattgagacacccgttcacgcgggcagattggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacattttttttacacacacacacacacacacacacactctaaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaacttgggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacaggggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgcggacgctttgttgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaa

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6483 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI

Specimen 6484

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6484
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6484 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgtatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatttataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaattgcactgtt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6484 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA gcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcctcggaaagcgcgcgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatgaaactaaacg

See sequence on NCBI

Specimen 6485

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6485
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6485 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA gccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgtatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatttataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaattccaagtggagggcaagtctggtgc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6485 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactagttcgctctaattatgttaaatatgctagtcctttcttgattatgtgataagtggtgcatggccgttcttatttcgtggagtgatctgtcggcttaattgcttttcactaatggcctataaatttacgtgtgttgcggcactttgacccctttcttctcaaagcgcgtgtcttatgttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgccygtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI

Specimen 6486

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6486
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6486 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgaatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatctataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6486 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaactaaacgaaa

See sequence on NCBI

Specimen 6592

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6592
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6592 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttaccttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggkggggacagaccattgttaattgttggtctcggtyttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6592 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI