Specimens identified by “Laure Apothéloz-Perret-Gentil” (3)

Specimen 14006

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14006
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATYTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTYTTAGTTCGTGGAGTGATCT GTYTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTG ACACGAAGGCAACGAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTAWAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTAWATTATTTTATTATTATTTTKGATTGCYCTTTTATTWAATTATAATKGGGTAGTTTTT AGATTTWATWAAAAATAWAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACARACCATTGCTAATTGTTGGWCTCGGWCTTAACTAGGAATGCCTTGTACGGGTCTT

See sequence on NCBI

Specimen 14007

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14007
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCT GTCTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGKG ACACGAAGGCAACRAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTATAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTATATTATTTTATTATTATTTTTGATTGCTCTTTTATTTAATTATAANTGGGTAGTTTTT AGATTTTATTAAAAATATAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACAGACCATTGCTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTGGTTCAACAAAC CACCCGGAATATGTCCCTGCCCTTTGTACACACCGCCCGTC

See sequence on NCBI

Specimen 14008

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14008
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCT GTCTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTG ACMCGAAGGCAACRAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTATAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTATATTATTTTATTATTATTTTTGATTGCTCTTTTATTTAATTATAATTGGGTAGTTTTT AGATTTTATTAAAAATATAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACAGACCATTGCTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTGGTTCAACAAAC CACCCGGAATATGTCCCTGCCCTTTGTACACACCGCCCGTC

See sequence on NCBI