Specimens collected by “Jean-Pierre Debenay” (12)

Specimen 9632

Species Textulariida > Carterinidae > Carterina > Carterina spiculotesta
Isolate number 9632
Collector Jean-Pierre Debenay
Identifier Jean-Pierre Debenay
Habitat Reef rubble
Depth 8m
Location New Caledonia, Uitoé
Latitude, Longitude -22.1667, 166.1

Barcode sequences

SSU partial

>HG425254.1 Carterina spiculotesta partial 18S rRNA gene, isolate 9632, clone 43 AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATCTGACTCAACGCGGAAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGTTCATCATCATGTGATGTGTTTTTCACGGAACACATTACATGCACACACAAAAATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTATCACTTTTAACGTGTATCAAACATATATTCAATATGTACTGACCTTGTTCACGCATGCGTCTATACATTGAGAATATATTTACACGTTGATAGCAACGAACGTGACCGTAATCCCTTGTTGCGATATTCACCTACTCTCACCCCGTGTTAATATCGCTAACTAGGGAGACCGCTGTATTCTTTCTTAAACCAGAGGAAGGTTACGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCCGCACACGTGCTACACTGATTATTGCAGTGAGTATCTTACTTAACTTGCTATGTGTATGCGTGTATGTTTACATACACAAATACACGCTCAAATAGCCTGCTTCGAAAGTTACCTCGCGGGTAATCAATTAGCAGTAATGATTTTCCATCATACATGCACATTATGTACGTATATTATACCCAGTGTGTGATTTATCACACACTCGTGTGTATAATATTACACGTACGTGCATTTTATCAATTCATGGTGGGGACAGACTATTGTTAATTATTAGTCTCGGTTTCAACTAGGAATGCCTTGTACTGGTTAGTTCAACAAACTACCAGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGAACTATACTGTGAGTTTATTGGACTCATACATTAAAATTTCCATTTTATGTATGGGAAAAATGCACGAACAGTGTGGTTTAAAGGAAAGAGAAGTCGAACAAGGC

See sequence on NCBI

SSU partial

Other sequence