Specimens identified by “Pamela Hallock” (10)

Specimen 676

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 676
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth <1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 676 | taxon:46130 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 756

Species Miliolida > Peneroplidae > Spirolina > Spirolina acicularis
Isolate number 756
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina acicularis | genomic DNA | 756 | marine sediment sample | taxon:577500 | 10 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccaggtccggacatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatgtttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgccgtctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 825

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis bradyi
Isolate number 825
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis bradyi | genomic DNA | 825 | taxon:128065 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagtatagtagtacacatgaatagttataatttggataactaagggaaagtttggctaatacgtttaattttttaaaaattaacatataataatattacaacatgatagatattatataaatattataaacactttattgtgttttaaaatatagagtagactttataataattataattataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacatgatattgaggcagtaacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatttttataaatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtataaaataattaatattttatatattatctgaatattcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatatattataacattttatttgtttttcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattatgcaatgaatgttttatcatgggatattgcatatataattaaaaattaatatcgatgaagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactttttgtttatttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatattattttatataattattcattatatattcttcaacttaattaaataatatttgattgagtataattttaatatactctcatataattatttttgttgtattatttaaataaataattaatattttaaatataattgattatatgtactttgcgctcatataataatataggtgagatgtaagcattattgatgaataattattttatatattntattatatataattaatatattataaatcaaattaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 835

Species Miliolida > Soritidae > Broeckina > Broeckina sp.
Isolate number 835
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Depth 30m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Broeckina sp. 835 | genomic DNA | 835 | taxon:128056 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagcatagttatagagatatagtttagttttggataactaagggaaagtttggctaatacgtttttaaaatgttattaatacacatttatgcatataataatattaattgcaacatgatagatattatataaatattttattcatttatttgaatataatatagagcagactttatatttattttaatataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatatattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtcccttaataatatttatattattttggttgataatataccaatgttataaaatattaaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatattaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaaaataaaatatataataatatcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgcttatatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtactattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatataatattcattctcaactaataattaatatgattgagttatattattactctcatataaataaatgttgtttttgttaataaaacatgtattgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattgatgattaatatactacatatataatatgtaagtattattataattcaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 836

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 836
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Depth 10m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 836 | genomic DNA | 836 | taxon:1032495 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA | 66 | 18 tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatgtattkttttagttatttatttggataactaagggaaagtttggctaatacgtttaaaatataatawtacattatgcatataataaatatttattttatgataaatattatataaatgaaaatacatttgtattttaatgtsgcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataaaactcagtaaaagaggtgaatattttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattytwattagttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatacatttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgcttataatattttttatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaatcacactccttactaacataaaatatataatatataatataattgagtcgtaaatacaactcttatatttaattattatttwtattattcattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgaataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttatttaaggatttaaagtgaacatattatatatatattattatataattaaatgaatgcaacgaacgtgaccgtaaccttttattgctattataattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataaaatataatatataatattatataacacctgtttcgaaagtaaatcggtagtcatttaaaaatcgtgatgaatattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 850

Species Miliolida > Soritidae > Androsina > Androsina lucasi
Isolate number 850
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Dwarf mangrove forests
Depth 2-10cm
Location USA, Florida Keys

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Androsina lucasi | genomic DNA | 850 | taxon:128069 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcaatatatagataacttaaatataagttacttggataactaagggaaagtttggctaatacgtttaaatgtattataataaatacatatgcatataataatattgcaacatgatagatattatataaaaataagatatattttattatatcttataagagcagactttataatattttaattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttataataaacttaattaatatataataattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattntatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttatyatattatttgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaactctcaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattattagcaatgaatgttttatcatggaatattgcatataatatttttgtcgatggaggtagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtatttttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattatactccttcaactaattaacattattttatatatgattgagtatttattttactctcatattaaatatatatattgatattttgataaaataaaatatcattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgattaatatgtatagtatttatatattattacattattatgaatcttatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 875

Species Miliolida > Peneroplidae > Spirolina > Spirolina arietinus
Isolate number 875
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina arietinus | genomic DNA | 875 | marine sediment sample | taxon:577499 | 13 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgganatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatatttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 876

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis proteus
Isolate number 876
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis proteus | genomic DNA | 876 | taxon:128066 | USA: Florida keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagattatcttaatataatatatttggataactaagggaaagtttggctaatacgttttaaatgtatttaataatacatatgcatataataatattattgcaacatgatagatattatataaaatgatatatattatcataagagcagactttataataataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacacaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtattttttgaatatgttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaataatatatagttaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattgctattttaataatatctctcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgatcgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 878

Species Miliolida > Soritidae > Cyclorbiculina > Cyclorbiculina compressa
Isolate number 878
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Location USA, Florida Keys

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Cyclorbiculina compressa | genomic DNA | 878a | taxon:128071 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagatagtatctataaatatataatattttggataactaagggaaagtttggctaatacgtttaaaatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataaattaaaatactttaatatgtatttttaatagagcagactttataatatatattattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatttttattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattatattaaccaatactgtgaacaaaccagagtgtataaaacatgtaatattttatattatgcaatgaatgttttatcatggaatattgctataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgtatatttaaccatattaaaatatgattgagtttattaaattatatatatactctcatataataatattataatattatatgtactttgcgctcatataataatataggtgagatgtaagcattattggtttacaatatacttatatattatttaattaatatataatgtattattgtaatcctaaattataaatataatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatacttagttgtatagtaagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacattaatattttagttctgccaatattatattggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataaatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattacattaataattatattaatacaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattataaaaataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggattataatatatattaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 879

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 879
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth < 1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Archaias angulatus | genomic DNA | 879 | taxon:46130 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatataataatagttatatttggataactaagggaaagtttggctaatacgttttagatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataatattataattacattattgtaattatataagagcagactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataatataacttaatatataataatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattttatattgttttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttaattatattatttgaattttcaagtggagggcaagtctggtgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatcacagactgtattcaatactgtgaacaaaccagaatgtataaaatatgttaatattaatatcattagcaatgaatgttttatcatggaatattgcatatttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcagactatgggatttcaattgaatatagtttacttcaactattaaataatatatgattgagtataattataatactctcatatttaattaatattttgaatattatttcaaattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgatcaatatatatactttttagtatgtattattgtaattctaattaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI