Specimens collected by “John J. Lee” (4)

Specimen 12953

Allogromia laticollaris_12953
Species "monothalamids" > Clade M > Allogromia > Allogromia laticollaris, strain CSH
Isolate number 12953
Collector John J. Lee
Description strain CSH

Barcode sequences

SSU partial

>Allogromia laticollaris | genomic DNA | 12953 | taxon:71427 | 1 | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgcnnattattgacaggttttnnnaagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcaggaattaaataaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccgggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctatcttctgattgagttctataagaatgtacgcgaacag

See sequence on NCBI

SSU partial

>Allogromia laticollaris | genomic DNA | 12953 | taxon:71427 | 2 | USA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgaggattgacaggtttttataagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcaggaattaaataaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccgggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctatcttctgnttgagttctataagaatgtacgcgaacag

See sequence on NCBI

Specimen 12954

Allogromia laticollaris_12954
Species "monothalamids" > Clade M > Allogromia > Allogromia laticollaris, strain CSH
Isolate number 12954
Collector John J. Lee
Description Strain CSH

Barcode sequence

SSU partial

>Allogromia laticollaris | genomic DNA | 12954 | taxon:71427 | 3 | USA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgangattgacaggtttttataagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaaacgaaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcagggaattaaataaatatataattttttgtatattttatcctgtttaaccaacttttgaaagtaagttggtaatcaattcgaagtaatgatttccctttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacagggcgggaactctatcttnnattgagttctataagaatgtacgcgaacagtgnnnnnnnnnnaagagaagtcgaacaaggcaaagggcgaattcg

See sequence on NCBI

Specimen 377

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 377
Collector John J. Lee
Collected on February 1997
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 377 | taxon:196924 | 1 | Israel:Elat, Red Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacttagtgttgtatctatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagaggggccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtaatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Heterostegina depressa | genomic DNA | 377 | taxon:196924 | 21 | Israel:Elat, Red Sea | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaacctaaccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcggcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacacacatacacacccatgctgctgcaacgtgtcaatacatatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacactcgtaatacacacacacgcatgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI

Specimen 647

Species "monothalamids" > Clade M > Allogromia > Allogromia laticollaris, strain CSH
Isolate number 647
Collector John J. Lee
Collected on October 1997

Barcode sequence

SSU partial

>Allogromia laticollaris | genomic DNA | 647 | taxon:71427 | 2 | single cell | USA | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgaggatcgacaggtttttataagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcaggaattaaataaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctatcttctgattgagttctataagaatgtacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI