Specimens identified by “Sergei Korsun” (2)

Specimen 10013

E. albiumbilicatum from White Sea E. albiumbilicatum from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium albiumbilicatum
Isolate number 10013
Collector Sergei Korsun
Identifier Sergei Korsun
Collected on May 2008
Location White sea, Umba, Russia
Latitude, Longitude 66.6553, 34.4086

Barcode sequences

SSU partial


See sequence on NCBI

SSU partial


See sequence on NCBI

Other sequences

SSU total

>Elphidium albiumbilicatum | genomic DNA | 10013.1 | taxon:933847 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatggagtggtaatcaatatattacccgacagtttaaataagtgattcgcaaccactcactatacacgcacgctgwatatacdacgcacgactcggtacaaactcgactatatgaagcctcttttattctatctcrcagggagtatagttttttacgccatacgtagagtataaacaacgcatagcatacacttatgcaactgcwgatagctgcttaatacagttacacttgtcttgacttggcaattaatacacacacaacgcggtgtatatatgatatgacacacactgcgcgttatacccacccacacacacagctaaaggtaaattatcttaaagcaagtgttacccggtaccaatgatcaacacgggaaggcaggccttaaaggagtatgccgatctgcggggaaagtaacctatgtgactagactgtatttactgagattttgaagttattaagccgtataaacaatccatgcgacatataacacgcagggtgtataatgtcccaagcgcgtaacatatcctgcgttgggtgtttatgaactatataccgaagggatatagataggtgctaacgtctgcaacacgtttggaacggcgcgtagtaaaacaagagaataaccttaatcgcatagcatttttacatatacgacgtggtgacgcgcgtatttgttattagtaacggcaggtggctatactaaatggcctttgactactcatgcagatcgcggggataatcatactaaaagccaatatancggcacccgtagagtgagtatcattgtgtacaatacaccaccgcgtgtattaattaatatactatagatgcgatntctgatgtaatccacccatacacacacacacacgacggataactcagggaaagtttggctaatacgtacgacacacacacacacacgatactaatactcggcactcaatgggatgtttatatacctcctttgcttcatgaaagacattgagtacgcttgcaccttccattcattaacgtgaatagcaaacacgctgagcagacttcaatatatttatatattgaagcgtgtcatacaagcatctatagcatcaagttacgggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcacagtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtaccaaacgcaggtatataatatggaataatttactgtaccgtcgtcgtcgtaaatacacgcattatatagtaccccttgacgcatacctttcaacgcagcgcgtatagtagaaattcccttctattatattcaatgtaatgaggcagtgacaagctgtaacggttgagtataaaaaatgacgagtgtctagcattgtcgccttcgggcttggcattattgctgacgcttcgtatgctcaattggactgcggtgagttcaatatactcagaaccattcatacacagccgccgctgtgtatgaattatctgaataacttcaagtagagggcaagtctggtgccagcagccgcggtaataccagctctactggcctatacaatcattgttgcggttaagaggctcgtagttggattggaaatatactgcacacacacacacgcagatatatatactacctacgggtggttcgactatcattaacacgcacgcacgcgcagatacaacactgtgaacaaatcagagtgtatcatacatgtcttttaattaaaattatgcattgaatgtctcatcatgggatgttgcaatatatactacgtgtcgcacacacgggatacaatgataagtcgatggggatagttggagttagcagtactgttgggcgagcggtgaaatacgttgaccctggcaagactaccagaagcgaaagcggctaactaggctattctctttgtgaatgtaccatacaccacgcacgcgcacgtatgacacacacaatatacacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaactatgggctctcattcgctacataatgcagagacaaaaacgacactccctcataacaaccatacaataaaaatatatacattacgccttgattgagcctaccctgctctcatatagtaatcaatattttatatacggtctcgatggacgtttttaaatatatatatttttatatatttatttgcgtgtaagctatccattggatacgcgtacactttgattttaggagctttgagctcatattatcaatggttagatgcaagtatcaatacatgtgtgtgagtcatattaatctatgacacacacacatacatacaaaacatgatacgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcaggaaatcttaccgggtccggacacactgaggattgacagataacgtgctgttatacggtgcaaaatatgatagctctttcataattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttggtatatataatgcatgttaattgcatttttaccatgcaacgaacgtgaccgcaacctcctgttgcactatagcttctcatggtgcaaaactagagggaccgctgtatttatttcttttagccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgtcccgggctgcacacgtgctacaatgattattgcactgcgtatcttctaacgcggcgatttaattaatttaaaatcaccgcgacacccgtgtcgataggctatacgggtaaccctttagaagtaatgatttccaatgtatttatatcaactcatggtggggacagaccattgataattgttggtctcggtcacaactaggaatgccttgtacgagttggttcattaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgga

See sequence on NCBI

SSU total

>Elphidium albiumbilicatum | genomic DNA | 10013.2 | taxon:933847 | SSU | SSU | small subunit ribosomal RNA cactcactatacacgcacgctgtatatacgacgcacgactcggtacaaactcgactatatgaagcctcttttattctatctcacagggagtatagttttttacgccatacgtagagtataaacaacgcatagcatacacttatgcaactgcagatagctgcttaatacagttacacttgtcttgacttggcaattaatacacacacaacgcggtgtatatatgatatgacacacactgcgcgttatacccacccacacacacacagctaaaggtaaattatcttaaagcaagtgttacccggtaccaatgatcaacacgggaaggcaggccttaaaggagtatgccgatctgcggggaaagtaacctatgtgactagactgtatttactgagattttgaagttattaagccgtataaacaatccatgcgacatataacacgcagggtgtataatgtcccaagcgcgtaacatatcctgcgttgggtgtttatgaactatataccgaagggatatagataggtgctaacgtctgcaacacgtttggagcgncgcgtagtaaaacaagagaataaccttaatcgcatagcatttttacatatacgacgtggtgacgcgcgtatttgttattagtaacggcaggtggctatactaaatggcctttgactactcatgcagatcgcggggataatcatactaaaagccaatatancggcacccgtagagtgagtatcattgtgtacaatacaccaccgcgtgtattaattaatatactatagatgcgatttctgatgtaatccacccatacacacacacacacgacggataactcagggaaagtttggctaatacgtacgacacacacacacacacgatactaatactcggcactcaatgggatgtttatatacctcctttgcttcatgaaagacattgagtacgcttgcaccttccattcattaacgtgaatagcaaacacgctgagcagacttcaatatatttatatattgaagcgtgtcatacaagcatctatagcatcaagttacgggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcacagtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtaccaaacgcaggtatataatatggaataatttactgtaccgtcgtcgtcgtaaatacacgcattatatagtaccccttgacgcatacctttcaacgcagcgcgtatagtagaaattcccttctrttatattcaatgtaatgaggcagtgacaagctgtaacggttgagtataaaaaatgacgagtgtctagcattgtcgccttcgggcttggcattattgctgacgcttcgtatgctcaattggactgcggtgagttcaatatactcagaaccattcatacacagccgccgctgtgtatgaattatctgaataacttcaagtagagggcaagtctggtgccagcagccgcggtaataccagctctactggcctatacaatcattgttgcggttaagaggctcgtagttggattggaaatatactgcacacacacacacgcagatatatatactacctacgggtggttcgactatcattaacacgcacgcacgcgcagatacaacactgtgaacaaatcagagtgtatcatacatgtcttttaattaaaattatgcattgaatgtctcatcatgggatgttgcaatatatactacgtgtcgcacacacgggatacaatgataagtcgatggggatagttggagttagcagtactgttgggcgagcggtgaaatacgttgaccctggcaagactaccagaagcgaaagcggctaactaggctattctctttgtgaatgtaccatacaccacgcacgcgcacgtatgacacacacaatatacacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaactatgggctctcattcgctacataatgcagagacaaaaacgacactccctcataacaaccatacaataaaaatatatacattacgccttgattgagcctaccctgctctcatatagtaatcaatattttatatacggtctcgatggacgtttttaaatatatatatttttatatatttatttgcgtgtaagctatccattggatacgcgtacactttgattttaggagctttgagctcatattatcaatggttagatgcaagtatcaatacatgtgtgtgagtcatattaatctatgacacacacacatacatacaaaacatgatacgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcaggaaatcttaccgggtccggacacactgaggattgacagataacgtgctgttatacggtgcaaaatatgatagctctttcataattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttggtatatataatgcatgttaattgcatttttaccatgcaacgaacgtgaccgcaacctcttgttgcactatagcttctcatggtgcaaaactagagggaccgctgtatttatttcttttagccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgtcccgggctgcacacgtgctacaatgattattgcactgcgtatcttctaacgcggcgatttaattaatttaaaatcaccgcagacacccgtgtcgataggctatacgggtaaccctttagaagtaatgatttccaacgtatataatatcaactcatggtggggacagaccattgataattgttggtctcggtcacaactaggaatgccttgtacgagttggttcattaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgga

See sequence on NCBI

Specimen 10017

E. williamsoni from White Sea E. williamsoni from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium williamsoni
Isolate number 10017
Collector Sergei Korsun
Identifier Sergei Korsun
Collected on January 2004
Location White sea, Umba, Russia
Latitude, Longitude 66.6553, 34.4086

Barcode sequences

SSU partial


See sequence on NCBI

SSU partial


See sequence on NCBI

Other sequences

SSU total

>Elphidium williamsoni | genomic DNA | 10017.1 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA gcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtgtgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgataggctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttatttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatatatatacacacatgttatatattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaaacgtaaaaagatacattcttatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttctcatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgaccccccgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacgccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggac

See sequence on NCBI

SSU total

>Elphidium williamsoni | genomic DNA | 10017.2 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattttttataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtgtgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgataagctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttatttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatatatatacacacatgttatatattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaacgtaaaaagatacattcttatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaatttatttctatatataaagatgctggttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatatactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatatctttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggac

See sequence on NCBI