Specimens identified by “Loic Pillet” (8)

Specimen A108

E. margaritaceum A108 E. margaritaceum A108 E. margaritaceum A108
Species Rotaliida > Elphidiidae > Elphidium > Elphidium margaritaceum
Isolate number A108
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Roscoff, France
Latitude, Longitude 48.7273, -3.99092

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattgttgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtatcgcgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttattattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattagttgtgtacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtattgtgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttataaattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium margaritaceum | genomic DNA | A108.1 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttaatatattaaccctatcagtttaaacatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttatattatcatacggcgctctacggataactcagggaaagtttggctaatacgtacgaacaacttctattgtcgcatacagttacgcatgaatgagattgtatacgtgcgcatgaatttatattcatcgcacaaggcagatattgtaatttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgagccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcagacgcgtaaattgcccaataatagtacatacggtatattcactctcattctattgaggcagcgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgacactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatatttgatttatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccaatatacacaatactgtgatcaaatcagcacgtatcacgtatgtaatattatacgcattgtatgtttattcatggaatgttgtatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacagtactacacgtacacgtacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaaatatattcgtatattcgtatacgttatatatcatattcgattttccaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtatttattacgtatgctatattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaggtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattgttgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtatcgcgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttattattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium margaritaceum | genomic DNA | A108.2 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA aaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttatattttcgatcatacggcgctcaacggataactcagggaaagtttggctaatacgtacgaacacacttctattgtcgcatacagttacgcatgaatgagattgtatacgtgcgcatgaatttattcatcgcacaaggcagatattgtaatttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatacggtatattcactctcattctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatattaatttatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggmctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccactatacacaatactgtgatcaaatcagcacgtatcacgtatgtattttttaatacgcattgtatgtttattcatggaatgttgtatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacagtactacacgtacacgtatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaaatatattcgtatattcgtatacgttatatatcatattcgattttctaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtatttattacgtatgctatattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattagttgtgtacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtattgtgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttataaattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen A13

E. margaritaceum A13 E. margaritaceum A13 E. margaritaceum A13
Species Rotaliida > Elphidiidae > Elphidium > Elphidium margaritaceum
Isolate number A13
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Trebeurden, France
Latitude, Longitude 48.7878, -3.5823

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaatttatattgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatatgtatacgtatgacccaataactatgttgttgtgtgtctagtattactatcatttgaaagcaacgaacgtgaccgtatccttttattatatacacacatgtatatctttttaaagggaccgctgttttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgatcatttcattaagtatcttgtgtatgtctcatacgatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccatatacttacgtgtatgcgtgtgtgttttattattcgtttgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtactctgtgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta See sequence on NCBI

See sequence on NCBI

Other sequence

SSU total

>Elphidium margaritaceum | genomic DNA | A13 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatyttwaaaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttactactactacgctcttacggataactcagggaaagtttggctaatacgtacgaacaaattctatattcgcatacagttacgcatgaatgagattgtatacgtgcgcatgtttattcatcgcacacggcagatattgtaattttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatacggtataattacttcacctcattctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatgtttcattacatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccaattgttacaatactgtgatcaaatcagcacgtatcacgtatgcatttttaatatgcattgtatgtttattcatggaatgttgtatttttatatgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacattacactctgtattcacactctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaatatatttatacgttttacgtattttatattattttactgattttctaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtattttattacgtgtgctaaattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaatttatattgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatatgtatacgtatgacccaataactatgttgttgtgtgtctagtattactatcatttgaaagcaacgaacgtgaccgtatccttttattatatacacacatgtatatctttttaaagggaccgctgttttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgatcatttcattaagtatcttgtgtatgtctcatacgatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccatatacttacgtgtatgcgtgtgtgttttattattcgtttgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtactctgtgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen A53

E. aculeatum A53 E. aculeatum A53 E. aculeatum A53 E. aculeatum A53
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number A53
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Trebeurden, France
Latitude, Longitude 48.7878, -3.5823

Barcode sequences

SSU partial

aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattacttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatgcgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | A53.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcawgtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttattatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtactatatacattattatacaatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgcagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattacttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatgcgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | A53.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA tattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcgccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatatctattgaggcagtgataagctgtaacggttgagtattaatctaatttggcgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatattttatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtactatatacattattatacaatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen C131

H. orbiculare C130 H. orbiculare C130
Species Rotaliida > Incertae sedis > Haynesina > Haynesina orbiculare
Isolate number C131
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Haynesina orbiculare | genomic DNA | C131.1 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttaaggaaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatgcgtgtgggtgtgggcacaggcacactcacacgcctttctctgttatctatacacattcagataactgcatggataactcagggaaagtttggctaatacgtacgggtacgatgcttacatgacacatatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgaacaactaagttctgtgcagtaaggcggggtagacctcgtgagctagtaaaccgcggtcagtcaccatcatagcatcacgccgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgngcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagggctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatatagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggacatagcatgtattatatatacgcacacgctctcacactattactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgcgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaagtattgcgtgcatatttacattacgcacattaggtttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttgaacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgattttgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaacattatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacatattctaagtgcagacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaaataatatatgtcgatggkgatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgatttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattvscctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU total

>Haynesina orbiculare | genomic DNA | C131.2 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttgaagcaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatatgcgtgtgggtgtgagcacaggcacaccacacacgctcatttctctgttatctatacacacgtcgttcgcgataactgcatggataactcagggaaaatttggctaatacgtacgggtacgatgcatatatgacacattatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgctgtgcagtaagccggggtaccaaagcggatcacatgctgtaagtcacagagctgattacatagtaacacgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgggcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagagctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatttagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggatatagcatgtattatatacacgcacacgctctcacactatactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgtgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaggtattgcgtgcatatttacattacgcacatagattttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttggacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgatattgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggctaagaggctcgtagttggattgaactaacatttatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacacgttctaattgccgacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaattaatatatgtcgatggggatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgagttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacatnscctccgggggtagtatgcacgcaagtgtgaaactkgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

Specimen C6

E. williamsoni from White Sea E. williamsoni from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium williamsoni
Isolate number C6
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttcttatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggactgtatcctttaatgaatacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequence

SSU total

>Elphidium williamsoni | genomic DNA | C6.1 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttttataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtatgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgacaagctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatacatatatacacaatgttattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaacgtaaaaagatacatttcatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttcttatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggactgtatcctttaatgaatacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen C62

E. excavatum A227 E. excavatum A227 E. excavatum A227
Species Rotaliida > Elphidiidae > Elphidium > Elphidium excavatum
Isolate number C62
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequences

SSU total

>Elphidium excavatum | genomic DNA | C62.1 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA agccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaatatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacactgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatacgcgttgtaggcaatttgttgatgtagtcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtatatcttcaaataccgtctataaacgtgtgtgtgtgtgtatgtattagatatttgtgcacgcgtgttgtatatacgtccctgtacttatttatgtgtgtgtggtgctatgtacgtgtcgtcgtatgctctctaaaaaaacacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcttgcacataaaaccaactcacccaaacggttttgtgttcacgcacacgcgcacatttctcacactttaaaaacgaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactntgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.2 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcgtacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacattcctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgccgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcgtttttactttcacaatccttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.3 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacctttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcatacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaaganccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacatttctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagtggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctataattgttgtgtaacacacacacccctttgagttgctttgtgtagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgctgggtaattttattgccacccacaatgcgcttcggtgctgcgtgtgtcctttatttttaccacgtgcgcgaacgtgcattctcattcatctaaaacgacgtgtgcatttatatagtcatatcttttgtgtttataatacagtacagtactcatcactcacattgcctttgtcgtggaagtgttgttgtgattttgttatgcgctgtgaacatcttttgcaacgcactatactcacgccaatcgcaagagcggtgtgtgttggstttattttatacacrcagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacracaakacactgttgcataggacacwttacaacgaagaacgaaggttgggggatcaaagaggatcagatacsctcgtcgtcccatttttacatcagacgatgggctctcaattgcacactttaccgtgtgtagntgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagntttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen D18

E. aculeatum D18 E. aculeatum D18
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D18
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D18.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgmagtggttatttaacccgacagtttaactaagtgttattaacgtcaatagattactaatctatacaacccacgtaacagtgaatgcacatttcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattgctatattcacgcttaatgcgcgaatcggcactacacaacacatacttgcttacgataataattatattattatcgggtaatacgtgatttcttcactgagaagctattgcattactgcagtacgcttatcataccattacaacacatcttatggataactcagggaaagtttggctaatacgtacgagtcacattacttcacacagcaattgttattcgcaatctgtcgcgtctaccgcattcatgaaacaaacattaattataaatgcgcgcgcgcactcatctgcgaaataactaaactaattactcagcactcaatggtaaacttatgcgtctgcgtacttctgtcttcggacgatgcgcttacgcatgattcgtttaactgcaacatgagagacattgagcacgcagtctttcgatccttcgtgattgattgacatctacgctgagcagactttaagattcttaatcttgaagcatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatatggcgtgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D18.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA tatttaacccgacagtttaactaagtgttattaacatcaatagattactaatctatacaacccacgtaacagtgaatgcacatttcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattgctatattcacgcttaatgcgcgaatcggcactacacaacacatacttgcttacgataataattatattattatcgggtaatacgtgatttcttcactgagaagctattgcattactgcagtacgcttatcacaccattacaacacatcttatggataactcagggaaagtttggctaatacgtacgagtcacattacttcacacagcaattgttattcgcaatctgtcgcgtctaccgcattcatgaaacaaacattaattataaatgcgcgcgcgcgcactcatctgcgaaataactaaactaattactcagcactcaatggtaaacttatgcgtctgcgtacttctgtcttcggacgatgcgcttacgcatgattcgtttaactgcaacatgagagacattgagcacgcagtctttcgatccttcgtgattgattgacatctacgctgagcagactttaagattcttaatcttgaagcatgtcatacaagcatctatagcaccaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatattttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagtggtgaaatgcattgacccttgcaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen D3

E. aculeatum D3 E. aculeatum D3
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D3
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D3.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagcatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtagttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagcaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.3 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggctattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagagagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaatgttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI