Specimens found in “Sea grass meadow” (3)

Specimen 1439

Species "monothalamids" > Clade F > Hemisphaerammina > Hemisphaerammina bradyi
Isolate number 1439
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on June 1999
Habitat Sea grass meadow
Depth <5m
Location Mediterranean Sea, Banuyls, France

Barcode sequence

SSU partial

>Hemisphaerammina bradyi | genomic DNA | 1439 | taxon:159868 | 2 | single cell | France:Banyuls | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgagggttgacaggtgtttcgtaaagttaacggtttagtaattgtttgtgccttcacgggtatttgcttttattgggctttttcatttacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggcgtgagtgagttattatagttctttcgtgacctcattatttcatttaatatgttattttgattgcgtccggttctatatgcttgccatcgccacgaaggcaacgaacgtgaccgcaacctcttgttgcctcccttgagcattatagttgaaattctcaatttatttgagttatttctttatatttgccacagtcttataagtgattcttttatctttttttaaacggaaaggtatttgtaatttactatatgttttttactgcagtggagggaaactagagggaccgctgacatttcttaaaccagagaaggttgcggcaataacaggtctgtgatgccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagttgcagctttaccatcaagtatgtttctttgtttttgtgcttggtgtttctcttaggagtatatcttgtgcatttgcattgtttcatgctggtaactctctgatgcatttgtttttatttagtaattattgcttagttgtagtgttgctttataatttttataactttaacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttccttttatttttatattttatagcacaatttacatgtccatagtcttttataggtggcgccttgcgtgttgctttataatgctattgtttggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaagccattaagttatttatttagcttaataatttattctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 676

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 676
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth <1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 676 | taxon:46130 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 879

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 879
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth < 1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Archaias angulatus | genomic DNA | 879 | taxon:46130 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatataataatagttatatttggataactaagggaaagtttggctaatacgttttagatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataatattataattacattattgtaattatataagagcagactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataatataacttaatatataataatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattttatattgttttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttaattatattatttgaattttcaagtggagggcaagtctggtgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatcacagactgtattcaatactgtgaacaaaccagaatgtataaaatatgttaatattaatatcattagcaatgaatgttttatcatggaatattgcatatttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcagactatgggatttcaattgaatatagtttacttcaactattaaataatatatgattgagtataattataatactctcatatttaattaatattttgaatattatttcaaattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgatcaatatatatactttttagtatgtattattgtaattctaattaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI