Specimens found in “salt marsh” (13)

Specimen 108

Ammonia sp. T5_108, spiral view Ammonia sp. T5_108, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aoteana T5
Isolate number 108
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on March 2000
Habitat salt marsh
Location New Zealand, Pollen Island

Barcode sequences

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 13 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnnnnggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgcttcggcaacaaacccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcctttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctctcacgctctcgcgcggaagcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 3 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcngtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgccctcgcgctaacaaaccccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctattcgctctcgggcggaagcttagtggaaatatatatggatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 108 | genomic DNA | 108 | taxon:155798 | 7 | single cell | true | New Zealand:Pollen Island | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaacaaaatacatgtgcctcgcgcgcatgatttagcccgtcgatactatcctagcatattaccggtctcggccggtaactcaatatgcgggaattgtagcatcgtaataataaaaaaaatatatatgtgcacgcacacacacacacacccaccgcgtacgtacttgtaaacacacagcgtctccgcgttggaaagcaagtttatatcctctttggatatgccatagagtgtgacagccacgtttcactcataaccgtacgcacacacacacgccccgtgcactaatatatatttctataacctgagtcgagttattt

See sequence on NCBI

Specimen 132

Ammonia aomoriensis T6_132, spiral view Ammonia aomoriensis T6_132, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aomoriensis T6
Isolate number 132
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on June 2000
Habitat salt marsh
Location China, Yalu Jiang

Barcode sequences

SSU partial
SSU partial

Other sequence

LSU partial

>Ammonia sp. 132 | genomic DNA | 132 | taxon:155816 | 8 | single cell | true | China:Yalu Jiang | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatatatttatgcgtctctggcgcatatttttagcccgtcgatactatcctagcgtattaccggtttcggccggtagcccaatacgcgggaattgtagcatcgtaataaaatatacaccatgcctgcgtcgcaaacgtatatacacgtatactcacacacacatactcgtacgcgtacacaccccttgcaaacacacagcgctcccgcgttggaaagcaagtctatatcctctttggatatgccatagagtgtgacagccacgtttgaaacaccctacgtaccgtacacacacacatacgtaaaaatacgcgctgcttcgcatacgcataccgtatataacctgagtcgagttattt

See sequence on NCBI

Specimen 175

Ammonia sp. T10_175, umbilical view Ammonia sp. T10_175, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T10
Isolate number 175
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on September 2000
Habitat salt marsh
Location USA, Washington State, Grays Harbour

Barcode sequences

SSU partial

>Ammonia sp. 175 | genomic DNA | 175 | marine sediment | taxon:155833 | 3 | true | USA:Grays Harbour | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggnnnnnnnnnnctcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtactctcgcgggtactatggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctccctcgcggaggcgtgtgtcgcacgtacgctatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttgtgcgtactaccactgcttagcgcgtgacacacttcggtgtgcccgcgcattaaactatagagaccgctgtttctcctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagtgcgtatgctcttcggagtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacacctttatgtgcgcgcgggctaaccgttctggtctctgtatcagttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccgaagttgcaccgtctcggcggcgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 175 | genomic DNA | 175 | marine sediment | taxon:155833 | 4 | true | USA:Grays Harbour | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggctnaannngactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtactctcgggtactatggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctctttaccgaggcgtgtgtcgcacgtacgctatgcgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttgtgcgtactaccactgcttagcatatatcgtgcctcgtgtatgattatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaatagcaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagtgcgtatactttcgggtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgctttagaccttggcacaccatatgtgcgcgcgggctaaccgttctggtctctgtaccagttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcgccgctcgcggtgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 175 | genomic DNA | 175 | taxon:155833 | 41 | single cell | true | USA:Grays Harbour | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataacacatatacgcgtcgttcgcgacgtgtatctttagcccgtcgatactatcctagcgtatgactctctgtctcggcagagtgtcgcctaatacgcgggaattgtagcatcgcaataaataatatacgtatatacgcgccacacacacataccaactcagtgccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcttcggatatgccatagagtgtgacagccacgtttggaacaccactcggcaactgatacacgcgcataatacataccgtatataacctgagtaaagttattt

See sequence on NCBI

Specimen 176

Ammonia sp. T10_176, spiral view Ammonia sp. T10_176, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T10
Isolate number 176
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on September 2000
Habitat salt marsh
Location USA, Washington State, Grays Harbour

Barcode sequences

SSU partial

>Ammonia sp. 176 | genomic DNA | 176 | marine sediment | taxon:155834 | 4 | true | USA:Grays Harbour, Washington State | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtgctctcgggcactgtggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctctttacgaggcgtgtgtcgcacgtacgctatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttggtgcgtactaccactgcttaggcgtgacacacttcggggggcccgcgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagcgcgtatgctcttcggagtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacacctttatgtgcgcgcgggctaaccgttccaacctctgtgttggttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgcaggactgccaaagcgccgcttgcggtgcttagtggaaatatatatgaatagtgtgatctaagggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

Other sequence

LSU partial

>Ammonia sp. 176 | genomic DNA | 176 | taxon:155834 | 44 | single cell | true | USA:Grays Harbour | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataacacatatacgcgtcgttcgcgacgtgtatctttagcccgtcgatactatcctagcgtatgactctctgtctcggcagagtgtcgcctaatacgcgggaattgtagcatcgtaataaataatatacgtatatacgcgccacacacacataccaactcagtgccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcttcggatatgccatagagtgtgacagccacgtttggaacaccactcggcaactgatacacgcgcataatacataccgtatataacctgagtaaagttattt

See sequence on NCBI

Specimen 243

Ammonia aberdoveyensis T2_243, spiral view Ammonia aberdoveyensis T2_243, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aberdoveyensis T2
Isolate number 243
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on June 1995
Habitat salt marsh
Depth <1m
Location Adriatic Sea, Lagoon of Venice, Italy

Barcode sequences

SSU partial

>Ammonia sp. 243 | genomic DNA | 243 | taxon:944410 | 7 | France:Camargue, Le Boucanet | Aug-1995 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagttcgctgcatgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaacgacaggcgtgtgtcgcacacgagtacctacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtgccttctgggtacgacccactgcttagtatatgtacgtgcttcggcgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcatgcatgtgctcttcggggtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaactaaatgtacgcgcatgttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatgaatctataggactgccaaagctttttggagcttagtggaaatatatatgnnnnnnnngatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 243 | genomic DNA | 243 | taxon:944410 | 5 | France:Camargue, Le Boucanet | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagtccgctgcatgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaacgacaggcgtgtgtcgcacacgcgtacctacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaaatgtgccttctgggtacgacccactgcttagtatatgtacgtgcttcggcgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacgggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccgcatgcatgtgctcttcggggtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaactaaatgtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtggcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgggttatgctatgaatctataggactgccaaagtacgcgtttcggcgccgcttagtggaaatatatatnnnnnncgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. | genomic DNA | VS13 | taxon:43993 | 6 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatgccaatatataatatgtacctcgcgtgcataaattagcccgtcgatactatcctagcgtatgtcaccggtcttcgggtcggtactcaaatacgcgggaattgtagcatcgtaataattaaaaaatatacagcacacacacacacacacacataagaacccacgccaacacagcgtacaccacttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttcaccctttagtacgcacacacatacaccaatggcgcggcgtgcgagtgcacaacgtatatatactataacctgagtcgagttattt

See sequence on NCBI

Specimen 464

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T7
Isolate number 464
Collector Susan Goldstein
Identifier Maria Holzmann
Collected on December 1995
Habitat salt marsh
Location USA, Georgia, Sapelo Island

Barcode sequences

SSU partial

>Ammonia sp. 464 | genomic DNA | 464 | marine sediment | taxon:998790 | 16 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcatagttcgctgtnncntagntganagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctctccgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttctggtcccttgtaccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcgacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggcaaag

See sequence on NCBI

SSU partial

>Ammonia sp. 464 | genomic DNA | 464 | marine sediment | taxon:998790 | 17 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcgctgcgcatagctgaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctcctcgcgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagggcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgctttagaccttggcacaatatatgtgcgcgcgggctaaccgttgtaacctctgtgttacttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 465

Ammonia sp. T7_465, spiral view Ammonia sp. T7_465, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T7
Isolate number 465
Collector Susan Goldstein
Identifier Maria Holzmann
Collected on December 1995
Habitat salt marsh
Location USA, Georgia, Sapelo Island

Barcode sequences

SSU partial

>Ammonia sp. 465 | genomic DNA | 465 | marine sediment | taxon:998791 | 1 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatattcatgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactgggtctccgatagcaaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcggctatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttgtaacctctgtgttacttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 465 | genomic DNA | 465 | marine sediment | taxon:998791 | 2 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcatagttcgctgtnncntagntganagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctctccgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcgggtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttctggtctcttgtaccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequences

LSU partial

>Ammonia sp. | genomic DNA | Amm GS 2 (from Georgia, USA) | taxon:43993 | 1 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataacagagactaaccaggattcccttagtaacggcgagtgaactgggataccaacaatatatatatacgcttcactgcgtgtatatctttagcccgtcgatactatcctagcgtatgacttatactgtctcggcagttggtcaccaaatacgcgggaattgtagcatcgtaacacatatatacactataagcagcgcacacgtatatacacacacatatacacgtataccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcctcggatatgccatagagtgtgacagccacgtttggaacacccttataccggtacacacacatacactcactgcgcatatacgcttagcacgatatataacctgagtcgagttattt

See sequence on NCBI

LSU partial

>Ammonia sp. | genomic DNA | Amm GS 2 (from Georgia, USA) | taxon:43993 | 3 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatatatattatatacgcttcatgcgtgtatactttagcccgtcgatactatcctagcgtatgacttatactgtctcggcagttggtcaccaaatacgcgggaattgtagcatcgtaacacatatatacactataagcagcgcacacgtatattatacacacacatacgtatataccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcctcggatatgccatagagtgtgacagccacgtttggaacacccttataccggtatacacacacatatacactgcgcatacgcttagcacgtatatataacctgagtcgagttattt

See sequence on NCBI

Specimen 607

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T9
Isolate number 607
Collector Jan Pawlowski
Identifier Maria Holzmann
Habitat salt marsh
Location USA, New York, Long Island

Barcode sequences

SSU partial

>Ammonia sp. 607 | genomic DNA | 607 | marine sediment | taxon:998794 | 13 | USA:Long Island, New York | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacattcatgcgntattatatcgtcggtgtaacgcaaataaatatgctagttctttcatgattatgtgataggtggtgcatgggccgttcttagttcgtggagtgatctgtcctgcttaattgcgtatcgtattaagtaggccatattatgtggggatcntctgcngccatngacccctcaacttcttagttgtagcgcgtgtcatgcgtacgatctcacttggccttatcgatagcaacngaacgtgaccgtattnctattgttgcagtgaaattcttaccactgcattgtgtgatacttttagtattgcacgtaaactantagagaccgctgtttctttcttaaaccagaggaaggttacggcaataacaggtctgtgatgccctcaaatgttccgggctgcacacgtgctacaatgatcattgcattgtgcatctaacccaatagtgtgtctagctcagcttacatgttgccttcgggtgatatgtaatgcgtgagcttggacgcctgaacctacttcgaaagtaaattttagtgggcaatctattagaagtaatgactcgcatttagaccaaaggcaacttatatgtacgcacatgcttagccggctcacctttgtgtgagtgcagtgcctaacatgttgttcgtacgcctatcgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgagtatgtaggactgtacgtgaccgtgaaaaatttatttttcactcaccatggaaatatacacgaatagtgtgatctannnnnnnaagagagaantcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 607 | genomic DNA | 607 | marine sediment | taxon:998794 | 15 | USA:Long Island, New York | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggantgacagacattcatgagttgttgcctcggcgcaactcatacaaatatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcgtattaagtaggccatatacgtgggatctctgcgccatgacccctcaacttctcagttgtagcgcgcgtcatacgtacgaatctcacttggcctatcgatagcaacgaacgtgaccgtattctattgttgcagtgaaattcttaccactgcattgtgtgatacttttagtgttgcacgtaaactatagagaccgctgtttctttcttaaaccagaggaaggttacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcattgtgcatctaacccaatagtgtgtctagctcagcttgcatgttgcttgcaatatgcaatgcgtgagcttggacgcctgaacctacttcgaaagtaaatnntagtgggcaatctattagaagtaatgactcgcatttcagaccaaaggcaacttatatgtacgcacatgcttagccggcttacctttgtgtgagtgcagtgcctaacatgttgtctcgtacgcctatcgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgagtatgtaggactgtacgtgaccgtgaaaaatttatttttcactcaccatggaaatatacacgaatagtgtgatctaaaggnannngaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. Ammp1 | genomic DNA | Ammp1 | taxon:155588 | 37 | true | USA:Long Island, New York | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctcaaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagtcgatgcaactttatacggagaccgatagcatacaagtaccgtaagggaaagatgaaaagcaccctattgagttcacgccgtcttagaaattatggcctcggccacttttcttatgacgcgcatacaactacagtgggagtgaaagagagagtgaaatcgcctatacgtgaaaatataaaatacacgcaacaacgtactgtattctatatagtctgcgatagtacaatcggacagagtgtggcattaacggccgtctgacttattctctcacactcagtgggtaagttatgattggcccatggttgatttttacaatcttccatacgcgacacaactgtacgacccgtcttgaaacacggaccaaggagttcaactggattacgagtcgtagcgttataatatataataagcgcatacggcatagcgaaagcaaacttatattactgtgccaggtcagccttaccgaggcttgtccgcagcacgcgctgagttagaatatacgtcggccgtaaggaaggcgtataccatataatttattatgtgggtaactcaagcgttcaacatcgagtacatcttgttgagacccgaaagatggtgaactatgcttggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctaagtataggggcgaaagactcatcgaaccatctagtagctggttccctccgaagtttccctcaggatagc

See sequence on NCBI

Specimen 641

Ammonia sp. T1_641, spiral view Ammonia sp. T1_641, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T1
Isolate number 641
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat salt marsh
Location Cuba, Playa Bailen

Barcode sequences

SSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 2 | true | Cuba:Playa Bailen | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgtcgtgcgttgagctctctcgggggccgagcgcatgactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcataaaaagagacctagtatacgcgtaagatatcgtttacggttcgtgacccccttcgggcgtgtgtcgcacgtacgtatcatacgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgaatgtatgcatcttcgggtgtatctaccgctgcttagtgcgtatgcgtacttcggtgcgtgtcgtacattaaactatagagaccgctgtattttttttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccacggtatgtatttatgcttcggcgtagtatatatcagttggtcggccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactnccatagaccatggtacacacttatatatgtacgcgcaggttctacccggccngcctttgtgtcggtgcagtgcgtancgngntntttcgtacgtancactctgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtctcacctaggaatncctggtacgggtctccggttcaacataccacccngaaaagatcccncccctttgaacncnccgcccgncnctctaganaanngannacactangaatntatagcactcccaaaggtgtnnggncccggtaagntagngganatagatacgaatagtgtgannnnnnnnaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 1 | true | Cuba:Playa Bailen | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggcgcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacagatatacgtcgtgcgttgagctctctcgggggccgagcgcatgactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcataaaaagagacctagtatacgcgtaagatatcgtttacggttcgtgacccccttcgggcgtgtgtcgcacgtacgtatcatacgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgaatgtatgcatcttcgggtgtatctaccgctgcttagtgcgtatgcgtacttcggtgcgtgtcgtacattaaactatagagaccgctgtattttttttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccacggtgatacgtttcggcgtatcattagttggtcgaccacgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggtacactctttatgtacgcgcaggttctacccggccggcctttgtgtcggtgcagtgcgtagcttgttgtttcgtacgtaccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtccctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaattgttgtacctcggtaccgcgcttagtggaaatatatnnnnntagtgtgatctaaaggaaagagaagtcgaaca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 1 | single cell | true | Cuba:Playa Bailen | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatacccaatatataccatctgtgcgtacctcggtgcgtacaaattttagcccgtcgatactatcctagcatagtactggcttcggccggtaacctatctatgcgggaattgtagcatcgtacaaaaatatattatacaacgtatatacgcaacccacacttatatatatttttatgcgtacacttactttcataaacacacagcgctcccgcgttggaaagcaagtctatatcctttttggatatgccatagagtgtgacggccacgtttcaactctctacgtatacgcatgcgttatatacatacactgtattttatatataacctgagtnaagttattt

See sequence on NCBI

Specimen 647-Amm

Ammonia sp. T11_647, spiral view Ammonia sp. T11_647, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T11
Isolate number 647-Amm
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat salt marsh
Location Cuba, Playa Bailen

Barcode sequence

SSU partial

>Ammonia sp. 647 | genomic DNA | 647 | marine sediment | taxon:155846 | 6 | true | Cuba:Playa Bailen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcgcgacctcgcttcggcgcgagtcacgctggaagacgctagatctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatccaaaaagagaccaagtatacgcgtagaaccacgtggtagtgaccccctctttaaccggaggcgtgtgtcgcacacgtattatacgcactggtctcggatagcaacgaacgtgaccgtactctattgttgcagtgaaacagtgcttgccttcgggctcgcacgacccactgcttagtatatatgcgcttcggcgcataatatacattaaactatagagaccgctgttttttccttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcaaatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaaagtgcgtggacaacaacacctgcgcggcttcggccgtgcgtgtgtatgattgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaaaataaagtacgcgcaggtctacccggctccgcctttgtgcagagtgcagtgtgtagcttgttgttttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagcgcttgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 647 | genomic DNA | 647 | taxon:155846 | 13 | single cell | true | Cuba:Playa Bailen | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataaaatatatatgccactcgttggcgtataatttagcccgtcgatactatcctagcatatttacctacggcttcggctgttcgtaaaataatatgcgggaattgtagcatcgtaataaaaaaatatacgtacaacacgcacaccgcaacgccataagcgtatataaaaagaaccttacttgtaaacacacagcgtacccgcgttgggaagcaagtatatatccttttggatatgccatagagtgtgacagccacgtttcaccctataataaaaggtcatacgcataacacaccgatacacccaaatggcaatgcatcgtgcataccgtacgaaaaatatattttttatataacctgagtcgagttattt

See sequence on NCBI

Specimen C131

H. orbiculare C130 H. orbiculare C130
Species Rotaliida > Incertae sedis > Haynesina > Haynesina orbiculare
Isolate number C131
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Haynesina orbiculare | genomic DNA | C131.1 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttaaggaaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatgcgtgtgggtgtgggcacaggcacactcacacgcctttctctgttatctatacacattcagataactgcatggataactcagggaaagtttggctaatacgtacgggtacgatgcttacatgacacatatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgaacaactaagttctgtgcagtaaggcggggtagacctcgtgagctagtaaaccgcggtcagtcaccatcatagcatcacgccgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgngcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagggctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatatagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggacatagcatgtattatatatacgcacacgctctcacactattactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgcgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaagtattgcgtgcatatttacattacgcacattaggtttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttgaacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgattttgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaacattatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacatattctaagtgcagacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaaataatatatgtcgatggkgatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgatttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattvscctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU total

>Haynesina orbiculare | genomic DNA | C131.2 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttgaagcaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatatgcgtgtgggtgtgagcacaggcacaccacacacgctcatttctctgttatctatacacacgtcgttcgcgataactgcatggataactcagggaaaatttggctaatacgtacgggtacgatgcatatatgacacattatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgctgtgcagtaagccggggtaccaaagcggatcacatgctgtaagtcacagagctgattacatagtaacacgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgggcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagagctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatttagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggatatagcatgtattatatacacgcacacgctctcacactatactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgtgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaggtattgcgtgcatatttacattacgcacatagattttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttggacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgatattgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggctaagaggctcgtagttggattgaactaacatttatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacacgttctaattgccgacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaattaatatatgtcgatggggatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgagttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacatnscctccgggggtagtatgcacgcaagtgtgaaactkgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

Specimen C6

E. williamsoni from White Sea E. williamsoni from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium williamsoni
Isolate number C6
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttcttatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggactgtatcctttaatgaatacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequence

SSU total

>Elphidium williamsoni | genomic DNA | C6.1 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttttataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtatgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgacaagctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatacatatatacacaatgttattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaacgtaaaaagatacatttcatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttcttatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggactgtatcctttaatgaatacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen C62

E. excavatum A227 E. excavatum A227 E. excavatum A227
Species Rotaliida > Elphidiidae > Elphidium > Elphidium excavatum
Isolate number C62
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequences

SSU total

>Elphidium excavatum | genomic DNA | C62.1 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA agccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaatatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacactgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatacgcgttgtaggcaatttgttgatgtagtcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtatatcttcaaataccgtctataaacgtgtgtgtgtgtgtatgtattagatatttgtgcacgcgtgttgtatatacgtccctgtacttatttatgtgtgtgtggtgctatgtacgtgtcgtcgtatgctctctaaaaaaacacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcttgcacataaaaccaactcacccaaacggttttgtgttcacgcacacgcgcacatttctcacactttaaaaacgaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactntgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.2 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcgtacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacattcctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgccgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcgtttttactttcacaatccttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.3 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacctttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcatacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaaganccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacatttctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagtggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctataattgttgtgtaacacacacacccctttgagttgctttgtgtagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgctgggtaattttattgccacccacaatgcgcttcggtgctgcgtgtgtcctttatttttaccacgtgcgcgaacgtgcattctcattcatctaaaacgacgtgtgcatttatatagtcatatcttttgtgtttataatacagtacagtactcatcactcacattgcctttgtcgtggaagtgttgttgtgattttgttatgcgctgtgaacatcttttgcaacgcactatactcacgccaatcgcaagagcggtgtgtgttggstttattttatacacrcagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacracaakacactgttgcataggacacwttacaacgaagaacgaaggttgggggatcaaagaggatcagatacsctcgtcgtcccatttttacatcagacgatgggctctcaattgcacactttaccgtgtgtagntgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagntttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI