Specimens found in “Brackish estuary” (1)

Specimen 490

Ammonia aberdoveyensis T2_490 Ammonia aberdoveyensis T2_490
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aberdoveyensis T2
Isolate number 490
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on October 1995
Habitat Brackish estuary
Depth <1m
Location Golf de Morbihan, Bretagne, France

Barcode sequences

SSU partial

>Ammonia sp. 490 | genomic DNA | 490 | taxon:944411 | 9 | France:Bretagne | Feb-1996 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagtgcttcggcgccgcatgggctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaaccgcaggcgtgtgtcgcacacgcgtaccacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtaccttcgggtacgacccactgcttagtgtgagcttgcctcgtgtaagcatcacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccgcgtgcatgtgctcttcggagtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactaaatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatggatctataggactgccaaagngcgcgcttcggcgccgcgctnagtggaaatatnnnnnnnnnnnnnnnnntaaangaaagagaagtccgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 490 | genomic DNA | 490 | taxon:944411 | 8 | France:Bretagne | Feb-1996 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgctgcgtgcttcggcgcgtgcattgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaaccgcaggcgtgtgtcgcacacgcgtaccacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtaccttcgcgggtacgacccactgcttagtatatgtacgtgcttcggtgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcgtgcatgtgctcttcggagtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactaaatgtacgcgcaggtctacccggctcgccttttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcgttgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatgaatctataggactgccaaagtgcgcgcttcggcgccgcgcttagtggaaatatatatgantagcgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. | genomic DNA | FS 21 (from Bretagne, France) | taxon:43993 | 1 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatgccaatataaaatatgtacctcgcgtgcataaattagcccgtcgatactatcctagcgtatgtaccggtcttcgggtcggtactcaaatacgcgggaattgtagcatcgtaataaaaaaaatatacagcacacgcacacacacacacataagaacccacgccaatgcgtacaacttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttcacccttaagtacgcacacacacacacatgaacccaccaaatggcgcggcacgtgcaagtgcaccgtatatataatataacctgagtcgagttattt

See sequence on NCBI