Specimens found in “Reef sediment” (8)

Specimen 1325

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 1325
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Habitat Reef sediment
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

>Peneroplis pertusus | genomic DNA | 1325 | marine sediment sample | taxon:46137 | 1 | USA:Florida Keys, Conch Reef | Apr-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 365

Species Miliolida > Alveolinidae > Borelis > Borelis schlumbergeri
Isolate number 365
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on January 1997
Habitat Reef sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Borelis schlumbergeri | genomic DNA | 365 | marine sediment sample | taxon:128061 | 16 | Israel:Elat | Jan-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttatcaggtccagacatattgaggattgacaggcgataacatataataatattttatatattattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaataatatatattataatatttttatatagttctgctcctatttttagtgagattgtgaacatatattttattatatatatattatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaaatatattaattactttggtattaatatataatatagcttaaaattaaaggaaccgctgtctattttaagtgcttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattatatattttcttataatatatattatttataaatctatataaaacctatttcgaaagtgaatgggtaatcatttaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 496

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 496
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis planatus | genomic DNA | 496 | taxon:128053 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaatagttataatccaaaatttggataactaagggaaagtttggctaatacgtttaatacgtaatacacatatatatattgcatattacgatatatcattattgcaacatgattgacgtaatataaatattataatacatttatttgtattaatatagagcagactttataatatttttataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgaataccttgtatacactatactcatatataatatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtataatttattatacattgcttgataatataccaatgttataaaatattggaatttgaatgcggtgattttaataatttcaagtacatggtataatatttattttaatattatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatatgtttacacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcayattaataaataattaattatttcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatgatatatattcccttcaatatacttaatacatttttatagttgagtatattattattatgtactcctatattaatatttgtgttttaatattgaatatttaattataatcataaatgattatatgtactttgcgctcataatatttaatcaggtgagatgtaagcattataggtgattaatatgcttatatatcatatgyatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 510

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 510
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 510 | marine sediment sample | taxon:128053 | 4 | Australia:Lizard Island | Sep-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagattattatatatttatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatgcattatatagtaatatataatttaatattgtgctgccttatatttatatataaggattttaagtgaacatattaatattgttttgctatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataattaatgttaattcattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatatcaactacacttaataagtgttaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatggtatatctatattatgtatatagtattttactattacataaataccattaactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacgtactatcagtacattgaaactcatacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 6668

Archaias angulatus 6668
Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 6668
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat Reef sediment
Location Brazil, Maracajau Reef

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Archaias sp. 6668 MH-2008 | genomic DNA | 6668 | marine sediment sample | taxon:577497 | Brazil:Natal | 25-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatagaaaataataatagttatatttggataactaagggaaagtttggctaatacgttttttgtattaataatacatatgcatataataatattgcaacatgatagatattatataaataataaatagtatttatttagtatagagtggactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttatgttattattaaacttaatatattatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatgttttaattttatatgttattcgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatattatatataatatacaatactgtgaacaaaccagagtgtataaaacatgtaatatttttaattattagcaatgaatgttttatcatgggatattgctaatatatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctatnaagactaacaaaagcgaaggcacttaactagattattctctttntattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataaattattctctcaactaataattaaaaatgattgagtgtaattatttaatatactctcatttataattatacatgttgatattacacactatgattatatgtactttgggctcatataattatataggtgagatgtaagcattatagatgattaatatatttactacatattgtaaatattattataattctaaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggnagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 756

Species Miliolida > Peneroplidae > Spirolina > Spirolina acicularis
Isolate number 756
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina acicularis | genomic DNA | 756 | marine sediment sample | taxon:577500 | 10 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccaggtccggacatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatgtttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgccgtctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 835

Species Miliolida > Soritidae > Broeckina > Broeckina sp.
Isolate number 835
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Depth 30m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Broeckina sp. 835 | genomic DNA | 835 | taxon:128056 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagcatagttatagagatatagtttagttttggataactaagggaaagtttggctaatacgtttttaaaatgttattaatacacatttatgcatataataatattaattgcaacatgatagatattatataaatattttattcatttatttgaatataatatagagcagactttatatttattttaatataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatatattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtcccttaataatatttatattattttggttgataatataccaatgttataaaatattaaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatattaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaaaataaaatatataataatatcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgcttatatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtactattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatataatattcattctcaactaataattaatatgattgagttatattattactctcatataaataaatgttgtttttgttaataaaacatgtattgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattgatgattaatatactacatatataatatgtaagtattattataattcaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 875

Species Miliolida > Peneroplidae > Spirolina > Spirolina arietinus
Isolate number 875
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina arietinus | genomic DNA | 875 | marine sediment sample | taxon:577499 | 13 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgganatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatatttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI