Specimens found in “pebble beach” (4)

Specimen 6200

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6200
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 3 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 6201

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6201
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6201 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcacgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatatttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6201 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgcgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttgattcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 6205

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6205
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6205 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA gacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttccgcgtgaatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgccctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatctataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgcggacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6205 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaaatttattctgcacacctatggaaacttaaacgaacagtgtgtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgatcctg

See sequence on NCBI

Specimen 6206

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6206
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequence

SSU partial

>Cibicidoides variabilis | genomic DNA | 6206 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaaggatca

See sequence on NCBI