Specimens found in “Reef rubble” (18)

Specimen 2264

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis spp.
Isolate number 2264
Collector Xavier Pochon
Identifier Maria Holzmann
Collected on March 2000
Habitat Reef rubble
Location Guam, Gun Beach

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis sp. 2264 | genomic DNA | 2264 | taxon:128067 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaatatatataaataaatgttatctttggataactaagggaaagtttggctaatacgtttaatgtattaataatacacattcatataataataatacaacatgattgatattatataaatataaaatacatttattgtattttaaatagagatgactttataatatttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttaatatataatataaaaatatacactcaatttaattgaggcagtgacaagctgtaaagattcaatataaaaataaagataacatttggaattgtcgctttataatatttatattatattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgaatgtaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatatacacaacactgtgaacaaatcagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgctaataatatataatataatataaacatgttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatagatatataccctcaacttaaatattaatatgattgagtataattatatactctcatatatatattaatgttgataaatatttgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattaatgattaatatacttataatttttaataattataatgtattattatgatttaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 642

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 642
Collector Maria Holzmann
Collected on September 1997
Habitat Reef rubble
Location Maldives, Helengeli

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 642 | taxon:196924 | 1 | Maldives:Helengeli | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacctagtgtgtatcaatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggaccgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Heterostegina depressa | genomic DNA | 642 | taxon:196924 | 15 | Maldives:Helengeli | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcgcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacatacacacccctgctgctgcaacgtgtcaatacacatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacgctcgtaatacacacacacgcacgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI

Specimen 751

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 751
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys, Tennessee reef
Latitude, Longitude 24.7712, -80.7623

Barcode sequence

SSU partial

>Sorites sp. 751a | genomic DNA | 751a | taxon:1032491 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatggtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgtaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatatttaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 825

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis bradyi
Isolate number 825
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis bradyi | genomic DNA | 825 | taxon:128065 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagtatagtagtacacatgaatagttataatttggataactaagggaaagtttggctaatacgtttaattttttaaaaattaacatataataatattacaacatgatagatattatataaatattataaacactttattgtgttttaaaatatagagtagactttataataattataattataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacatgatattgaggcagtaacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatttttataaatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtataaaataattaatattttatatattatctgaatattcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatatattataacattttatttgtttttcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattatgcaatgaatgttttatcatgggatattgcatatataattaaaaattaatatcgatgaagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactttttgtttatttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatattattttatataattattcattatatattcttcaacttaattaaataatatttgattgagtataattttaatatactctcatataattatttttgttgtattatttaaataaataattaatattttaaatataattgattatatgtactttgcgctcatataataatataggtgagatgtaagcattattgatgaataattattttatatattntattatatataattaatatattataaatcaaattaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 836

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 836
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Depth 10m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttatttaaggatttaaagtgaacatattatatatatattattatataattaaatgaatgcaacgaacgtgaccgtaaccttttattgctattataattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataaaatataatatataatattatataacacctgtttcgaaagtaaatcggtagtcatttaaaaatcgtgatgaatattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 836 | genomic DNA | 836 | taxon:1032495 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA | 66 | 18 tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatgtattkttttagttatttatttggataactaagggaaagtttggctaatacgtttaaaatataatawtacattatgcatataataaatatttattttatgataaatattatataaatgaaaatacatttgtattttaatgtsgcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataaaactcagtaaaagaggtgaatattttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattytwattagttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatacatttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgcttataatattttttatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaatcacactccttactaacataaaatatataatatataatataattgagtcgtaaatacaactcttatatttaattattatttwtattattcattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgaataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttatttaaggatttaaagtgaacatattatatatatattattatataattaaatgaatgcaacgaacgtgaccgtaaccttttattgctattataattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataaaatataatatataatattatataacacctgtttcgaaagtaaatcggtagtcatttaaaaatcgtgatgaatattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 876

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis proteus
Isolate number 876
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis proteus | genomic DNA | 876 | taxon:128066 | USA: Florida keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagattatcttaatataatatatttggataactaagggaaagtttggctaatacgttttaaatgtatttaataatacatatgcatataataatattattgcaacatgatagatattatataaaatgatatatattatcataagagcagactttataataataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacacaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtattttttgaatatgttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaataatatatagttaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattgctattttaataatatctctcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgatcgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 9632

Species Textulariida > Carterinidae > Carterina > Carterina spiculotesta
Isolate number 9632
Collector Jean-Pierre Debenay
Identifier Jean-Pierre Debenay
Habitat Reef rubble
Depth 8m
Location New Caledonia, Uitoé
Latitude, Longitude -22.1667, 166.1

Barcode sequences

SSU partial

>HG425254.1 Carterina spiculotesta partial 18S rRNA gene, isolate 9632, clone 43 AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATCTGACTCAACGCGGAAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGTTCATCATCATGTGATGTGTTTTTCACGGAACACATTACATGCACACACAAAAATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTATCACTTTTAACGTGTATCAAACATATATTCAATATGTACTGACCTTGTTCACGCATGCGTCTATACATTGAGAATATATTTACACGTTGATAGCAACGAACGTGACCGTAATCCCTTGTTGCGATATTCACCTACTCTCACCCCGTGTTAATATCGCTAACTAGGGAGACCGCTGTATTCTTTCTTAAACCAGAGGAAGGTTACGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCCGCACACGTGCTACACTGATTATTGCAGTGAGTATCTTACTTAACTTGCTATGTGTATGCGTGTATGTTTACATACACAAATACACGCTCAAATAGCCTGCTTCGAAAGTTACCTCGCGGGTAATCAATTAGCAGTAATGATTTTCCATCATACATGCACATTATGTACGTATATTATACCCAGTGTGTGATTTATCACACACTCGTGTGTATAATATTACACGTACGTGCATTTTATCAATTCATGGTGGGGACAGACTATTGTTAATTATTAGTCTCGGTTTCAACTAGGAATGCCTTGTACTGGTTAGTTCAACAAACTACCAGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGAACTATACTGTGAGTTTATTGGACTCATACATTAAAATTTCCATTTTATGTATGGGAAAAATGCACGAACAGTGTGGTTTAAAGGAAAGAGAAGTCGAACAAGGC

See sequence on NCBI

SSU partial

Other sequence