Specimens found in “reef slope, hard bottom” (1)

Specimen 300

Species Miliolida > Alveolinidae > Alveolinella > Alveolinella quoyi
Isolate number 300
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on October 1996
Habitat reef slope, hard bottom
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Alveolinella quoi | genomic DNA | 300 | taxon:128059 | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataatatatatatttcggtatatatatacaaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattgatatatatatatagttctgctctttgaattaagagattgtgaacatatattatattatgtatataatatttattaaatgaatgcaacgaacgtgactataaccttttattgctatattaacaagtattttnnntattatatatattattatataattagcttaaaattaaaggaaccgctgtcttatttaagtacttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcactttaataagtgtctaattaaacaaatnaattttatatataaataattctatttgtatataaaattcataataaacctatttcgaaagtgaatgggtaatcatttaaaaacgtgataaattaatttcatactacattatataaatataattatattaatatcattcatatgattattaattagttttatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaactatattattttcggataatataaaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Alveolinella quoi | genomic DNA | 300 | taxon:128059 | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcatttgtcttgacttagccatataatagatgtatttataataatacacaaataaatccaatacaatttggataactaagggaaagtttggctaatacggtacaataatatatttaatagaaattacattgtaataattctattaaataaaaaaaaataaatatacgcacatattgagaattatgattaacaatatgtaagtattatattacttttgtaatatataacagagcagacttaattaatatattttaattaagcatgtcatacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcactgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgataaaacatgctatatacataataatcaataatatatatatataattgattaacacacaaaaacaatataccttgtttaactgtaatactcttttgaggcagtgacaagctgtaaagattcattattatcttaagacttcatttggaattgtcgctataatatatttttatatattatagcttgataatataccaatgaagtaatataatgaatttgaatgcggtgattgtaataatttcaagtaacatgaataaacatttagttgtttatttgttatctgaattttcaagtagagggcaagtctggtgcaatcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattgttgcggttaagaggctcgtagttggattgaaattacaaatgaatataatcattgatatatktaatataatgattcatatttcatttcaatactgtgaacaaaccagagtgtataaaacatgtaatataatttattattatgcattgaatgtttcatcatggaatattgcatataacataaattacaacttatacacagtacagtatataataagacatatatatagtatgtcgatggagatagttggagttaaaggtactgataagcgagcggtgaaatgctttgaccttattaagaccaacaaaagcgaaagcatttaactagattatactctttgtcgtcagtacgaacaatcaatataatatatatatttgattgcgtacaagtcaatttttacaatgaagagcgaaggttaggggaacaaagaggatcagataccctcgtcgtcctatttatacatcaaacgatgggatttcaattgaatatattatatacttattaattaagtatatattatagttttatttgttcctttaacaattaattttatatatggttgagttttatattcaaaactcctatattaaaattattattgntaattaaaatatttctatatatatcttatcttaattaattaatcaattattaatacttataaccattggggtttttgnatttaattggattatatgtacttmggcgctcaaatatataggtgagaagtaarcctttattataatnttattaggttattaatantaancttttaattgganttaattaatatttaaccttaantaaaaangnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataatatatatatttcggtatatatatacaaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattgatatatatatatagttctgctctttgaattaagagattgtgaacatatattatattatgtatataatatttattaaatgaatgcaacgaacgtgactataaccttttattgctatattaacaagtattttnnntattatatatattattatataattagcttaaaattaaaggaaccgctgtcttatttaagtacttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcactttaataagtgtctaattaaacaaatnaattttatatataaataattctatttgtatataaaattcataataaacctatttcgaaagtgaatgggtaatcatttaaaaacgtgataaattaatttcatactacattatataaatataattatattaatatcattcatatgattattaattagttttatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaactatattattttcggataatataaaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI