Specimens found in “Epizoic/Gastropod test” (4)

Specimen C35

Cibicidoides lobatulus_C35
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C35
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C35 | M. Schweizer C35 (UniGE) | taxon:325267 | small subunit ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctg

See sequence on NCBI

Specimen C37

Cibicidoides lobatulus_C37
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C37
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C37 | M. Schweizer C37 (UniGE) | taxon:325267 | small subunit ribosomal RNA cgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcaaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaac

See sequence on NCBI

Specimen C39

Cibicidoides lobatulus_C39
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C39
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C39 | taxon:325267 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen C40

Cibicidoides lobatulus_C40
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C40
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C40.3 | M. Schweizer C40 (UniGE) | taxon:325267 | small subunit ribosomal RNA ctgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgccttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaaagtgggtaaatcaattagaagtaatgattttcctttttttagcacacatatatacggcgtctatgcccgggattacctgttgtagcttttgtgcgtatagatgtttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI