Specimens found in “Gulf of Eilat, Israel” (17)

Specimen 1282

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1282
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Depth 2m
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Sorites sp. | genomic DNA | 1282 | taxon:126664 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatttatttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgaaaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccggccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 13131

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13131
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 13 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggtttaatttgactcaacgcgagagatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgtcccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 16 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatataagtttatatatttaatttttatatgaaaatatgcgacctttttcnnnntatgagaaagggggcgnagcgccgctcatgattnnnngagagatctgtctctttaattgcgtttcactaagggctttatttataacacgtgtgggacggcactttgacccttttgttgcagtaaaatatatgngataaatatgtgcgtgtcttagtattgagcttagtctcgcacaaatgagtcctgaaagcaacgaaacgagaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtactctttttaaaccagaagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagagagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 14 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatattttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggttaatttcactcaacgcgagaaatcttactgggtccgtacacactgaggattgacattcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgtttcttagttcgtggagtgatctgtctgctttaattgcgtttcactaagggcttatatttataatacgtgtgttgacgggcacttttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgtagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggacccgctgtaatctttttaaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccggggctgcacacgtgctacaatgattattgcagtgagcatcccattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13132

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13132
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Eggerella sp. 13132 | genomic DNA | 13132 | marine sediment | taxon:998801 | 20 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaaacctgcttcgaaagtaagngggaaatcaatttgaagtaatgatttnccgtaaaatataaatttattttatatttaatagcacacatatatatanncggcatctttacccaacgcacagcttgtctgtcgtttcgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccngaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatgctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13133

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13133
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13133 | genomic DNA | 13133 | marine sediment | taxon:998802 | 23 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatctggtatgcgtcactacccactgcttagcgtgtacgtaccttcccggtgtgtcgtgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcggctatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttcgggccttctgtgccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacgcaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13133 | genomic DNA | 13133 | marine sediment | taxon:998802 | 24 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcgtgtacgtatatcccgtatgcgtcgcgcactaaacctatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctacgcgggtaatccattagaagtaatgactcgctttagaccttggcacgatatatgtgcgcgcgggctaaccgttgtaacctctgtgttactccagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatangaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13136

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13136
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Eggerella sp. 13136 | genomic DNA | 13136 | marine sediment | taxon:998803 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattctaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggggcgtggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgctccgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13195

Spirotextularia.sp_13195
Species Textulariida > Incertae sedis > Spirotextularia > Spirotextularia sp.
Isolate number 13195
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 1 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatcatattcataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacgattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacatttaaacgcgtgttatgtatttttatacatttcacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgtgtccaattatttacgtactatttcagtgcgtactttaattgtgtacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttaccccgcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtatctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 2 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatgctnntantcctttcatgattatgtgataggtggtgcatgccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgatcgcaacctcttgttgcctttatatacatttaaacgcgtgttatatatttttatatatttcacgtaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacacaccgcatgcgcgtgtccaattatttacgtactatttcaaatgcgtactttaattgtgtacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatatatgcacacatatatacggcatctttacccngcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 3 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatncgnnacccntttcntgattatgtnanaggtggtgcatggtcgttcttaggtcggggagggaacngtctgcttaaatgccnttnactnaaggnttaaaaatatannngtgtggnantgntttttgncccctatcgttgnaatattacgtgnagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgngaccgcaacctcttgttgcctttacatttaaacgcgtattatgtatttttatacattttacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggktgsggcaataacaggtctgtgaagsccttagaagttccgggcygcacacgtggctcaatgattattgcagktggcatctcatttatttcacaccgcatggcggtgtcccattatttacgtactatttcaagtccgaccttwawtgtgtaccattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttacccngcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 4 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagctgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacatttaaacgcgtgttatgtatttttatacatttcacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgtgtccaattatttacgtactatttcagtgcgtactttaattgtgtacattgcgcgcggtaaagccctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttaccccgcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccccccccgnatnnggtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13207

Spirophtalmidium sp._13207
Species Miliolida > Ophtalmidiidae > Spirophtalmidium > Spirophtalmidium sp.
Isolate number 13207
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtgggtgtatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggacttgnttgtagcttaagccggtgaaatgannnnnngagaacgaacgtgacccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 1 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnatgtggcttannnnnnctcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcagtattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 2 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaacagcgcgtggagctgtggcttanntngactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttagaaacaaggcaaataatatacagaggctctatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggnnnnnnnaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 4 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctctatatatataatataggggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggancgctagaaatactcgttaaaacggaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccatatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 5 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcaagtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggncgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatntccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgngnncnnnngtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13213

Siphonaperta sp._13213
Species Miliolida > Hauerinidae > Siphonaperta > Siphonaperta sp.
Isolate number 13213
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 26 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggnnnatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgnttnctttggcgacttcggtcaaaagggaagnnttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagantcccgcctgtgcttgtggtacgccacgagtacggtttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccnntttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgaagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 28 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccgacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 1359

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 1359
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 1359 | marine sediment sample | taxon:128053 | 7 | USA:Florida Keys | May-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggtcgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaaataatacacttggccttaactaggaatgccttgtactcttctttggtttaacattccaagaggaatacgtccctgccctttgtacacaccgcccctcgctcttaccgatgaattatattataaatctaaaggacaaacagattcctaaattgaatacattgaatcttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 1361

Species Miliolida > Soritidae > Amphisorus > Amphisorus hemprichii
Isolate number 1361
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Amphisorus hemprichii | genomic DNA | 1361 | taxon:126669 | Israel: Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaaaatgttattttatttttataggataactaagggaaagtttggctaatacgtttaattttacacatgtaaatatgcatataataatattgcaacatgatagatattatataaatataaatataaatattttatttatattaatatagagcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatataattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttattattttatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattatattttacattacttttgtaatgttaatactgtgaacaaaccagagtgtataaaacatgtaatattatatatattatgcaatgaatgttttatcatggaatattgtttatttcgatggagatagttggagttaagagtacttataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataatatattattcttaatacccctaacatatttaatatttattgattgagataattaatatatttatctctcataaaatataaaataatatagtggtacaatatttattatatgtactttgagctcatataattaatataggtgagatgtaagcattataggtgaacaatatatttatattataaatattattggaatccttataaataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1368

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1368
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Depth 1-2m
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatttatttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgaaaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 1368 | genomic DNA | 1368 | taxon:128051 | Israel: Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatataaatattaatagttatttatttggataactaagggaaagtttggctaatacgtttaaaatataataatacattatgcacataataatatttatatatgataaatattatgtaaataaaaaatacttttagtatttttaatagagcagactttataatattttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttagtttaatttgaactcaatatataatatttttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatacatttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctttttaatataatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattactacctcttttataaacatttaatcatttattatatataattgagtacttaattgtttactcttatatttaatattattatttttattattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgaataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatttatttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgaaaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 14006

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14006
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATYTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTYTTAGTTCGTGGAGTGATCT GTYTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTG ACACGAAGGCAACGAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTAWAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTAWATTATTTTATTATTATTTTKGATTGCYCTTTTATTWAATTATAATKGGGTAGTTTTT AGATTTWATWAAAAATAWAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACARACCATTGCTAATTGTTGGWCTCGGWCTTAACTAGGAATGCCTTGTACGGGTCTT

See sequence on NCBI

Specimen 14007

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14007
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCT GTCTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGKG ACACGAAGGCAACRAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTATAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTATATTATTTTATTATTATTTTTGATTGCTCTTTTATTTAATTATAANTGGGTAGTTTTT AGATTTTATTAAAAATATAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACAGACCATTGCTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTGGTTCAACAAAC CACCCGGAATATGTCCCTGCCCTTTGTACACACCGCCCGTC

See sequence on NCBI

Specimen 14008

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14008
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCT GTCTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTG ACMCGAAGGCAACRAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTATAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTATATTATTTTATTATTATTTTTGATTGCTCTTTTATTTAATTATAATTGGGTAGTTTTT AGATTTTATTAAAAATATAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACAGACCATTGCTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTGGTTCAACAAAC CACCCGGAATATGTCCCTGCCCTTTGTACACACCGCCCGTC

See sequence on NCBI

Specimen 362

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 362
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on January 1997
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 362 | marine sediment sample | taxon:128053 | 1 | Israel:Elat | Jan-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatatgtaatatataatttaatattgtgctgccttatatatataattatataggattttaagtgaacatattttattattacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaagggggggatagtgtattgttaaatattacacttggccttaaccaagaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggacaaacagattcctaaattgaatacattgaatcttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 365

Species Miliolida > Alveolinidae > Borelis > Borelis schlumbergeri
Isolate number 365
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on January 1997
Habitat Reef sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Borelis schlumbergeri | genomic DNA | 365 | marine sediment sample | taxon:128061 | 16 | Israel:Elat | Jan-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttatcaggtccagacatattgaggattgacaggcgataacatataataatattttatatattattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaataatatatattataatatttttatatagttctgctcctatttttagtgagattgtgaacatatattttattatatatatattatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaaatatattaattactttggtattaatatataatatagcttaaaattaaaggaaccgctgtctattttaagtgcttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattatatattttcttataatatatattatttataaatctatataaaacctatttcgaaagtgaatgggtaatcatttaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 377

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 377
Collector John J. Lee
Collected on February 1997
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 377 | taxon:196924 | 1 | Israel:Elat, Red Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacttagtgttgtatctatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagaggggccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtaatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Heterostegina depressa | genomic DNA | 377 | taxon:196924 | 21 | Israel:Elat, Red Sea | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaacctaaccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcggcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacacacatacacacccatgctgctgcaacgtgtcaatacatatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacactcgtaatacacacacacgcatgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI