Specimens found in “USA, Florida Keys” (6)

Specimen 756

Species Miliolida > Peneroplidae > Spirolina > Spirolina acicularis
Isolate number 756
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina acicularis | genomic DNA | 756 | marine sediment sample | taxon:577500 | 10 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccaggtccggacatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatgtttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgccgtctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 825

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis bradyi
Isolate number 825
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis bradyi | genomic DNA | 825 | taxon:128065 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagtatagtagtacacatgaatagttataatttggataactaagggaaagtttggctaatacgtttaattttttaaaaattaacatataataatattacaacatgatagatattatataaatattataaacactttattgtgttttaaaatatagagtagactttataataattataattataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacatgatattgaggcagtaacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatttttataaatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtataaaataattaatattttatatattatctgaatattcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatatattataacattttatttgtttttcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattatgcaatgaatgttttatcatgggatattgcatatataattaaaaattaatatcgatgaagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactttttgtttatttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatattattttatataattattcattatatattcttcaacttaattaaataatatttgattgagtataattttaatatactctcatataattatttttgttgtattatttaaataaataattaatattttaaatataattgattatatgtactttgcgctcatataataatataggtgagatgtaagcattattgatgaataattattttatatattntattatatataattaatatattataaatcaaattaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 850

Species Miliolida > Soritidae > Androsina > Androsina lucasi
Isolate number 850
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Dwarf mangrove forests
Depth 2-10cm
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Androsina lucasi | genomic DNA | 850 | taxon:128069 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcaatatatagataacttaaatataagttacttggataactaagggaaagtttggctaatacgtttaaatgtattataataaatacatatgcatataataatattgcaacatgatagatattatataaaaataagatatattttattatatcttataagagcagactttataatattttaattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttataataaacttaattaatatataataattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattntatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttatyatattatttgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaactctcaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattattagcaatgaatgttttatcatggaatattgcatataatatttttgtcgatggaggtagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtatttttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattatactccttcaactaattaacattattttatatatgattgagtatttattttactctcatattaaatatatatattgatattttgataaaataaaatatcattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgattaatatgtatagtatttatatattattacattattatgaatcttatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 875

Species Miliolida > Peneroplidae > Spirolina > Spirolina arietinus
Isolate number 875
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina arietinus | genomic DNA | 875 | marine sediment sample | taxon:577499 | 13 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgganatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatatttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 876

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis proteus
Isolate number 876
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis proteus | genomic DNA | 876 | taxon:128066 | USA: Florida keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagattatcttaatataatatatttggataactaagggaaagtttggctaatacgttttaaatgtatttaataatacatatgcatataataatattattgcaacatgatagatattatataaaatgatatatattatcataagagcagactttataataataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacacaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtattttttgaatatgttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaataatatatagttaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattgctattttaataatatctctcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgatcgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 878

Species Miliolida > Soritidae > Cyclorbiculina > Cyclorbiculina compressa
Isolate number 878
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatacttagttgtatagtaagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacattaatattttagttctgccaatattatattggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataaatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattacattaataattatattaatacaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattataaaaataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggattataatatatattaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cyclorbiculina compressa | genomic DNA | 878a | taxon:128071 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagatagtatctataaatatataatattttggataactaagggaaagtttggctaatacgtttaaaatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataaattaaaatactttaatatgtatttttaatagagcagactttataatatatattattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatttttattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattatattaaccaatactgtgaacaaaccagagtgtataaaacatgtaatattttatattatgcaatgaatgttttatcatggaatattgctataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgtatatttaaccatattaaaatatgattgagtttattaaattatatatatactctcatataataatattataatattatatgtactttgcgctcatataataatataggtgagatgtaagcattattggtttacaatatacttatatattatttaattaatatataatgtattattgtaatcctaaattataaatataatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatacttagttgtatagtaagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacattaatattttagttctgccaatattatattggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataaatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattacattaataattatattaatacaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattataaaaataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggattataatatatattaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI