Specimens found in “Atlantic Ocean, Bermuda ” (1)

Specimen 191

Species Miliolida > Alveolinidae > Borelis > Borelis schlumbergeri
Isolate number 191
Collector Colomban de Vargas
Collected on May 1996
Location Atlantic Ocean, Bermuda

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Borelis schlumbergeri | genomic DNA | 191 | taxon:128061 | Bermuda | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcatttgtcttgacttagcataaaatasatgtttaattacattyatagcaaaatccattaaaatatatttaatatattttggataactaagggaaagtttggctaatacgtacaatacattatatattaatttaacattggtaattaatatatataatacatacgcatatattgaattcattgcaacatgattgacaatatataagtatttatattacttcggtaatatataacaccagcagacttaattaatatttgtthaattaagcatgtcatacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcactgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgataaaacatgctaatatataattaatataattaatataaattatattaatacatatatttaaacaatacaaccttgtttaactatctctcttttgaggcagtgacaagctgtaaagattcattattatcttaagacttcatttggaattgtcgctataatatatttttatatattatagcttgataatataccaatgaagtaatataatgaatttgaatgcggtgattgtaataatttcaagtaacattaataaatatttagttatttattatttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaaaatcaattggaaaatatatatattaacacaatatacttaatatatatattatttcaatactgtgaacaaaccagagtgtataaaacatgtaatataatttattattatgcattgaatgtttcatcatggaatattgcatacataatataataaataatatattacatataatttatatacaattgtgtcgatggagatagttggagttaaaggtactgataagcgagcggtgaaatgctttgaccttattaagaccaacaaaagcgaaagcatttaactagattattctctttgtcttatatatacatgcaatatataaacacgtattatatattggcaatagtatatattcatttttacaatgaagagcgaaggttaggggaacaaagaggatcagataccctcgtcgtcctatttatacatcaaacgatgggatttcaattgaatatttttatatacttattaattaagtatatataatatgtttatttgttcctttaacaattaattatttatatggttgagtttaatttgaactcctatatattaattaatgttaatttaaatatttctattatatttcatcttaattaattaattaatattaatatattatgcccttgtgtatttatattaattgattatatgtactttgcgctcaatttataggtgagatgtaagcattattatattgtattagtttttatataatctttattgtattattataataacttaatataatatatatcacaaatgtaatgygatgcacgttytaggtacaagcttactatagaaatatttaaaataataccctcctggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataacatataatatatatttaatatatattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattataatatttttatatagttctgctccttttgtgagattgtgaacatatattttattatatatataaaatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaataaattaattactttggtattaatatataatacagcttaaaattaaaggaaccgctgtctattttaagtgcttaaacagtgtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattataatttttataatatatattatttataaatctatataaaaacctatttcgaaagtgaatgggtaatcatctaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI