Specimens found in “USA, Florida Keys, Tennessee reef” (1)

Specimen 751

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 751
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys, Tennessee reef
Latitude, Longitude 24.7712, -80.7623

Barcode sequence

SSU partial

>Sorites sp. 751a | genomic DNA | 751a | taxon:1032491 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatggtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattgtaattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatatttaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI