Specimens found in “Adriatic Sea, Mavarstica, Ciovo, Croatia” (4)

Specimen 6669

Laevipeneroplis karreri_6669 Laevipeneroplis karreri_6669
Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis karreri
Isolate number 6669
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

aagggcaccacaagaacgcctggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatatttttatataaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis karreri | genomic DNA | 6669 | marine sediment sample | taxon:577496 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagattatcttaatataatatatttggataactaagggaaagtttggctaatacgttttaaatgtatttttaataatacatatgcatataataatattgcaacatgatagatattatataaaatgatatatttaatatatcataagagcagactttatatttttttttaaatataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaactcaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatatataatttcaagtaacatgtatttctgacaaaatatgttatctgaattttcaagtggagggcaagtctggtgcagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataataatttgtagttaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattgctataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgattgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctagggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcctggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatatttttatataaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 6670

Laevipeneroplis karreri_6670; juvenile specimen
Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis karreri
Isolate number 6670
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

>Laevipeneroplis karreri | genomic DNA | 6670 | marine sediment sample | taxon:577496 | 13 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatatttttatataaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccactcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 6674

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 6674
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis pertusus | genomic DNA | 6674 | marine sediment sample | taxon:46137 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaaatatagttagttatatttggataactaagggaaagtttggctaatacgtttatataatacgtaaatataatatttatagcatattatgatatcattgcaacatgattgacataatataaatatataatacatttatttgtattaatattttgcagactttatagtaattataacttataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtaattaatatatataatatataccttgtatactgtattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcnctttgtataatttattatacattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgattttaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaataattatacatattatatacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcaatataattataaatattattgttagttagttatatcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgtaagcncttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatgtgatacatataatataatattcccttcaacttatattatacatgtatagttgagtacttaatttgtactcctatatatattataaattgaatatttattaattataatcataaatgattatatgtactttgcgctcatattatttaaaaggtgagatgtaagcattataggagagtaatatacttatatcatattatatgtgtataatgtattattataatccttaattaataaacgtaatgngatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 6675

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 6675
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 6675 | marine sediment sample | taxon:128053 | 14 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctgttataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatactgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI