Specimens found in “USA, Florida Keys, Conch reef” (3)

Specimen 1325

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 1325
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Habitat Reef sediment
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

>Peneroplis pertusus | genomic DNA | 1325 | marine sediment sample | taxon:46137 | 1 | USA:Florida Keys, Conch Reef | Apr-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 835

Species Miliolida > Soritidae > Broeckina > Broeckina sp.
Isolate number 835
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Depth 30m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Broeckina sp. 835 | genomic DNA | 835 | taxon:128056 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagcatagttatagagatatagtttagttttggataactaagggaaagtttggctaatacgtttttaaaatgttattaatacacatttatgcatataataatattaattgcaacatgatagatattatataaatattttattcatttatttgaatataatatagagcagactttatatttattttaatataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatatattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtcccttaataatatttatattattttggttgataatataccaatgttataaaatattaaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatattaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaaaataaaatatataataatatcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgcttatatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtactattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatataatattcattctcaactaataattaatatgattgagttatattattactctcatataaataaatgttgtttttgttaataaaacatgtattgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattgatgattaatatactacatatataatatgtaagtattattataattcaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 836

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 836
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Depth 10m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttatttaaggatttaaagtgaacatattatatatatattattatataattaaatgaatgcaacgaacgtgaccgtaaccttttattgctattataattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataaaatataatatataatattatataacacctgtttcgaaagtaaatcggtagtcatttaaaaatcgtgatgaatattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 836 | genomic DNA | 836 | taxon:1032495 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA | 66 | 18 tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatgtattkttttagttatttatttggataactaagggaaagtttggctaatacgtttaaaatataatawtacattatgcatataataaatatttattttatgataaatattatataaatgaaaatacatttgtattttaatgtsgcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataaaactcagtaaaagaggtgaatattttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattytwattagttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatacatttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgcttataatattttttatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaatcacactccttactaacataaaatatataatatataatataattgagtcgtaaatacaactcttatatttaattattatttwtattattcattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgaataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttatttaaggatttaaagtgaacatattatatatatattattatataattaaatgaatgcaacgaacgtgaccgtaaccttttattgctattataattataattatagcataaaattaaaggaaccgctgtcattactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataaaatataatatataatattatataacacctgtttcgaaagtaaatcggtagtcatttaaaaatcgtgatgaatattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI