Specimens found in “Great Barrier Reef, Lizard Island” (8)

Specimen 478

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 478
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 478 | taxon:126667 | Agamont | Australia:Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatgtaatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatatttatattaatatatattataaagacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 483

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 483
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat soft sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 483 | genomic DNA | 483 | taxon:128074 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatatgttatgaatagttatttggataactaagggaaagtttggctaatacgtttaataataaatatacatataatattttaatgatagatattatataaattaaaaatacatttatttgtattttaaatagagtagactttatattattataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgattaatatataaccttgtattactgacttttattgaggcagtgacaagctgtaaagattaaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatatttaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttaattattttatatgttatcagaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatattattatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgctaatatattatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattttattactctcaactaattaattaaatatgattgagaagtaattctctctatttaaatattttatgagataaataattatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgatcaatatatattatattatataatatattattgtaatccttaaaattaaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 489

Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 489
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccataattatttggatttaaagtgaacatattatttatattattatataataaatgaatgcaacgaacgtgaccgtagccttttattgctattaataatttaaattatagcataaaattaaaggaaccgctgtcatttactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataattatatattttatataataaagtaacccatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatatttaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattatattatattataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites sp. 489 | genomic DNA | 489 | taxon:1032490 | Australia:Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatagatagtatagttatttaatatttggataactaagggaaagtttggctaatacgtttttaaatgtaaataatacattatgcatataataaatataatatatgataaatattatataaatattgatatacatttatttgtatattttaatgattgcagactttataatatttttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtaataataacttaataaatatatattatttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttatattttattagttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaaaacaatactgcgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctaattgawactgtatttcatgtttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaatcaaccaatatatatacatgtaatatataatataattgagtcattaatactgactcttatatttgaatatgttattcatttattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggattttcataatatataagtaatattatattattatgatccttatttataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgnnnnnnnnnnnnnttgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccataattatttggatttaaagtgaacatattatttatattattatataataaatgaatgcaacgaacgtgaccgtagccttttattgctattaataatttaaattatagcataaaattaaaggaaccgctgtcatttactaaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataattatatattttatataataaagtaacccatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatatttaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattatattatattataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 494

Species Rotaliida > Nummulitidae > Operculina > Operculina ammonoides
Isolate number 494
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcattactatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatattttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaacaaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttcatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina ammonoides | genomic DNA | 494 | taxon:378197 | 5 | Australia | Aug-1997 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacatccatacagtgaatcactgaaatgtattacattacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctctatatatgcatggtacatgtatcatgtaatatatattctgtatacacacatacattgatttctctgtatcgcgcttatcttaataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatatcatttacatacacatacacctatcaatgtatctatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacatacagtgtgcagcatatataacacaattatatttactctgtcacccgacagtgtacatacatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgagtgaattctaattcattctgcgtttgatagttttttacgtgctacctttatacggttcgcgtatcgacgctacctaaaatgaaattattaccacgtatacggtttaccgtgctacagtaatatttcttatacacgcacactcgctcgctgtatcacacatacataacctactgcagcaactgagtgatcaatataccatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtgcatcgcacacacatacacacccgctgcacacagcgcttagtaagcttatattacgctatgtatataattcataacggttataaatgtcgatgggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcaggtgattatatattttctatcgcagtcacacacacatacatacacacttctgcagcagagatattatataacacttacagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctagtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgtaacataagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttgggcatttcatctgtcgtgttgtaattaaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcattactatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatattttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaacaaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttcatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 496

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 496
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis planatus | genomic DNA | 496 | taxon:128053 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaatagttataatccaaaatttggataactaagggaaagtttggctaatacgtttaatacgtaatacacatatatatattgcatattacgatatatcattattgcaacatgattgacgtaatataaatattataatacatttatttgtattaatatagagcagactttataatatttttataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgaataccttgtatacactatactcatatataatatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtataatttattatacattgcttgataatataccaatgttataaaatattggaatttgaatgcggtgattttaataatttcaagtacatggtataatatttattttaatattatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatatgtttacacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcayattaataaataattaattatttcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatgatatatattcccttcaatatacttaatacatttttatagttgagtatattattattatgtactcctatattaatatttgtgttttaatattgaatatttaattataatcataaatgattatatgtactttgcgctcataatatttaatcaggtgagatgtaagcattataggtgattaatatgcttatatatcatatgyatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 499

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 499
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatatttatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Marginopora vertebralis | genomic DNA | 499 | taxon:126667 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagtataatgttaataatagttatttataggataactaagggaaagtttggctaatacgttttaacagtattataattcttaatacacatataataatattataatatgataaatattatataaatattttaatacatttatttgtattaatatatagagttgactttataacatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttataataaaatatataatgtatatatattgaatactcaatatttatattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatattttttaatattatattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatgtaataatttcaagtaacatgtataaaatatttatattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaacatatataccaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctataatgaatattaatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattcacactaaacactaaacattataattataattatgattgagtatatgtcaaaatattactctcatattaaataattattatatatatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataaagtgaataatatacaagtaatattgtattattatgatctttaaaataaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatatttatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 500

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 500
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 500 | taxon:126667 | Gamont | Australia:Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataatattttaatattatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccttgaatattattcaaggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatacttatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatatattaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 510

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 510
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 510 | marine sediment sample | taxon:128053 | 4 | Australia:Lizard Island | Sep-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagattattatatatttatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatgcattatatagtaatatataatttaatattgtgctgccttatatttatatataaggattttaagtgaacatattaatattgttttgctatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataattaatgttaattcattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatatcaactacacttaataagtgttaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatggtatatctatattatgtatatagtattttactattacataaataccattaactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacgtactatcagtacattgaaactcatacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI