Specimens found in “Guam, Piti” (1)

Specimen 1634

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 1634
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Habitat soft sediment
Location Guam, Piti

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatttattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgccttaatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatttttatattttaaatatataatatagcataaaattaaagggaccgctgtctaaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatacaaatatatattttattatatatttataaaacctatttcgaaagtaaattggtaatcatttaaaaatcgtgattaataaaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggactattttaatatatatttatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 1634 | genomic DNA | 1634 | taxon:128073 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatgatgtaaataagttatttaattattttggataactaagggaaagtttggctaatacgtttaatttttaaatatgtttaattacatatacatataataaaaatcatttttttattgcaacatgatagatattatataaattaaaaatatatatttatttatatattttaaatagaggagactttataattattaattataatattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtactattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgatatttataccttgtattactatactcaatatatatatattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtaatattttatatattatattgcttgataatataccaatgttataaaatattgaatctgaatgcggtgaatataataatatcaagtaacatgtataaaatatttaattattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatatatatataatttatttttatacaatactgtgaacaaatcaaagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgcattaataaaataatattttatattttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatatatttattatatatttaatttatatttcttctcaacataattatatatgattgagcgtattatatatactctcatattttaatattaatgttataaaaaaatataatttaaattaaaaaactattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggagatcaatatatattatgtaaataatatattattgtaatccttaattataaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatttattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgccttaatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatttttatattttaaatatataatatagcataaaattaaagggaccgctgtctaaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatacaaatatatattttattatatatttataaaacctatttcgaaagtaaattggtaatcatttaaaaatcgtgattaataaaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggactattttaatatatatttatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI