Specimens found in “Gulf of Eilat, Taba, Israel” (4)

Specimen 1305

Sorites sp._1305
Species Miliolida > Soritidae > Sorites > Sorites spp.
Isolate number 1305
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Depth 20m
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatgatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattattatttaattatagcataaaattaaagggaccgctgtcattactaaatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Sorites orbiculus | genomic DNA | 1305 | taxon:87144 | Israel: Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatataaatatttgatagttatttatttggataactaagggaaagtttggctaatacgtataaaatataataatacattatgcacataataatatttatatatgataaatattatgtaaatgaaagtatttttttactttaatagagcagactttataatatttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttttaaaaactcaatatataatatttttattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgttttataatatttttaatattacattacttgataatataccaatgttataaaatattcaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttcaattttattagttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatacattttttacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatatatttagcaatgaatgttttatcatggaatattgctttttaatataatatcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagatcattctctttgtattattacaatgaagagcgaaggttggggggacaaagaggatcagataccctcgtagtcctattttcacatcaaactatgggatttcaattactgtacacctctatatttaattatttattataatataattgagtacttaattgtttactcttatatttaatatatattatttttataattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgagtaattataagtaatattatatattatgatccttaataaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataaaaatatatatttttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatgatatattataatatttagttctgcctttatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctattattatttaattatagcataaaattaaagggaccgctgtcattactaaatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatactttataatatataatattatattacaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaattaatataaatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttattataattaaaatataaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1363

Species Miliolida > Soritidae > Amphisorus > Amphisorus hemprichii
Isolate number 1363
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

>Amphisorus hemprichii | genomic DNA | 1363 | taxon:126669 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1404

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1404
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequences

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 7 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggggtgtgtcgcacatacgttatacgcatagnnnntaggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgattcttctttaaaccagaggaaggatacsgcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgccttggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatatcatcatagtagaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 8 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgnnggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcacgattatgtgataggtggtgcatggccgttcttagttcgcggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggcgtgtgtcgcacatacgttatacgcataggtctcagatagcmaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 1405

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1405
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | marine sediment | taxon:155775 | 11 | true | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcntgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctcgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtaaaaccatatggtttgtgaccccctcgttaagaggcgtgtgtcgcacatatgtgttatacgcataggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagcatatagctgcgtcttaccaacgcgcaatatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcgcacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaccttcgcttgcgagggttagtggaaatatgtatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | taxon:155775 | 9 | single cell | true | Israel:Taba | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactatgtgcataatttagcccgtcgatactatcctagcatattaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaatatttatatacgtataacctacgcacacacacacatacctaaccgccaatatgtttctacgtactaggcaccttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcgcccatagtacgcgtataacatacacacacacatacacccaatggcgcgccggcagtgcagtgcacgtaaccatactgtatatatataacctgagtcgagttattt

See sequence on NCBI