Specimens found in “Guam, Double Reef” (3)

Specimen 1610

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 1610
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Double Reef

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 1610 | taxon:126667 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataatattttaatattatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatgcataatatgtatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatattgaatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatataaaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggagtacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1635

Species Miliolida > Soritidae > Amphisorus > Amphisorus kudakajimaensis
Isolate number 1635
Collector Xavier Pochon
Identifier Jan Pawlowski
Collected on July 1999
Location Guam, Double Reef

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatgttataaatctaagggacttataatatttattttaggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Amphisorus kudakajimaensis | genomic DNA | 1635 | taxon:1005670 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagtatgttataaatagttatgtaataggataactaagggaaagtttggctaatacgtttaattttacacatgtaaatatgcatataataatattgcaacatgatagatattatataaatataaatataaatatttatttatattaatatagagcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatataattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaggtaacatgtataaaatatttattattttatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattaacacacattactttttgtaatgttaatactgtgaacaaaccagagtgtataaaacatgtaatattatatatattatgcaatgaatgttttatcatggaatattgtttatttcgatggagatagttggagttaagagtacttataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataatatattattcttaatacccctaacatatttaatatttattgattgagataattaatatatttatctctcataaaatataaaataatatagtggtacaatatttattatatgtactttgagctcatataattaatataggtgagatgtaagcattataggtgaacaatatatttatattataaatattattggaatccttataaataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatgttataaatctaagggacttataatatttattttaggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 1636

Species Miliolida > Soritidae > Amphisorus > Amphisorus kudakajimaensis
Isolate number 1636
Collector Xavier Pochon
Identifier Jan Pawlowski
Collected on July 1998
Location Guam, Double Reef

Barcode sequence

SSU partial

>Amphisorus kudakajimaensis | genomic DNA | 1636 | taxon:1005670 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatatttattttaggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI