Specimens found in “Guam, Luminao Beach” (1)

Specimen 1645

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 1645
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Luminao Beach
Latitude, Longitude 13.13, 144.644

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 1645 | taxon:126667 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaactcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatgcataatatgtatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatattgaatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatataaaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI