Specimens found in “Japan, Ishigaki” (1)

Specimen 866

Species Rotaliida > Calcarinidae > Calcarina > Calcarina defrancii
Isolate number 866
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on July 1998
Location Japan, Ishigaki

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtggtatcccagttattaactgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgcattgcggcgctttgacccctcttaactgagcgttgtgtcttagttagcttagctttcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcataccacatacacaatttattttgtgttgaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgagtctgattaatttattttaatcatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattaggagtaatgatttccattattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctttgtgtgtatcgatgtatcttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgttcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Calcarina defrancii | genomic DNA | 866 | marine sediment sample | taxon:203400 | Japan:Ishigaki | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctatacacacatagtaacagtgataatttcatatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacacacacacacaatatgtgatttctctgtatcgcacacattatctttaaggtcttgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtatcaacacacacatcacatacacactactcagcactcaatggtaaactttggttcacacatcgttcgcgattgtaccagtttaaaagtttaactgcaacatgagagacattgagcacgcactgtgtgatatttatatcgcacaattccacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttanttattgattattacgcgttaacaacaatttacacacacacagnnnnnnnnnnnnacatttattctgtacacacacacacatccttgttaactcgcatcagataaattacatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgtacttggtgttatgaattaatttcactgtgcatgtatctgaatttcaagtggagggaaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacttattttatgagttcgttttctcgacgctaaccactgattttattacgcacgtaataatttctcaacacacacacacatacgctccagcgatatcgatacacgctcacactccatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactattcagcctgttggaaatacgttacacgcataattatnntctaacggttattaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtctcgcactctgtatcacacacacacatcacacacagagagtgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttcttttataagattgcaaacactcctcaacctacaaaatgacttggcttgagctcgtatctctgatacgctcgctagactattttcgtacggtctcgatggacgtttcatttattctattttttgcgtgtaagcattgtaattattctttgaaacataagaatttactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtttattgttacccgcagtgtatattttcgaatatttcacttgtcgtgtttgtaactaaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattgatttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtggtatcccagttattaactgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgcattgcggcgctttgacccctcttaactgagcgttgtgtcttagttagcttagctttcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcataccacatacacaatttattttgtgttgaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgagtctgattaatttattttaatcatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattaggagtaatgatttccattattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctttgtgtgtatcgatgtatcttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgttcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI