Specimens found in “Oslofjord, Norway” (20)

Specimen 12249

Bolivina skagerrakensis_12249 Bolivina skagerrakensis_12249
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12249
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 1 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA cgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagnctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagnncattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccnnccggaataaatnncccnccccctttgnacacnccncccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaactcgcgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 2 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaaactcgcgtatcatattaggaaacttaaaaaaacagtgtggtctaaaggaaagagaagtcgaacaaggc

See sequence on NCBI

Specimen 12250

Bolivina skagerrakensis_12250 Bolivina skagerrakensis_12250
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12250
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12250 | taxon:673208 | 4 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatctcatatgttctgcgtgtgaggtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatcataccctcggatatgacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactgcctgtgatattcgcgtatcatattaggaaacttaa

See sequence on NCBI

Specimen 12251

Bolivina skagerrakensis_12251
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12251
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12251 | taxon:673208 | 7 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacacgctcgcgttgtaggtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatagggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttctatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatattatatattgcttcggcgtgtgtagtgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatcttcacggatacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgatatattgcttcaccgtgtgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcga

See sequence on NCBI

Specimen 12268

Globobulimina turgida_12268 Globobulimina turgida_12268
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12268
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>FR754376 AAGGGCACCACAAGAACGCGTGGAGCNTTTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTCACCACATCAGTAATATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATTTACGTATGTTGCGACACTTTGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACGTGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATTAATATATTATACATATTGCTATATATAATATTATGTGTCATTGCCACTAACCTGGTAGTGTCTACATATTTTGTATATAATTTATGCACAGAAAGCTTTTTAAACTAGAGGGACCGCTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCATTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGCGGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTACTGAATTTTTTTGGTATAGTAATTCTGCACACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGTATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTACGTTTATTTATGCACACCTATGGAAACNTAAACGAACAGTGTGGTCTAAAGGAAAG

See sequence on NCBI

SSU partial

>FR754377 AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTCACCACATCAGTAATATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATTTACGTATGTTGCGACACTTTGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACGTGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATTAATATATTATACATATTGCTATATATAATATTATGTGTCATTGCCACTAACCTGGTAGTGTCTACATATTTTGTATATAATTTATGCACAGAAAGCTTTTTAAACTAGAGGGACCGCTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCATTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGCGGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTACTGAATTTTTTTGGTATAGTAATTCTGCACACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGTATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGCCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTACGTTTATTTATGCACACCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGAACAAGGCA

See sequence on NCBI

Specimen 12270

Globobulimina turgida_12270
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12270
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>FR754378 AAGGGCACCACAAGAACGCGTGGAGCTTTTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTTTTAACGCACATCAGTAAT ATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGT TCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATCTACGTATGTTGCGACACTT TGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACG TGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATAATATATTA TACATACTGCATACATAATATTATGTGTCATTGTCACTAACTAAAAATATAAGACTTGTCTTTTTTTTTT ATGTTGTGTAGTGTCTTTACATATTTTGTATATCTTTATGCACAGAAAGCCTTTTAAACTAGAGGGACCG CTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGC TGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCA TTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGC GGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTATCATTTTTTTGGTATAGTAATTCTGCAC ACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGT ATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATG CCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCG CTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTTATTTATTTATG CACACCTATGGAAAC

See sequence on NCBI

Specimen 3599

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 3599
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctntttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatc

See sequence on NCBI

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattacactctcacgcacacacacacacacacacacacgagattcgttacggtagtaacaatttcagcgtgaatcacctttacacagtgaatcactgaaattacccattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcatttcaaacaggagagagaatttattttttcccgcctgctttgaattgcatactatcacacatgctgattgttgcaatcattcgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtatcacacacacacacacactcgcacacattttatgattcgctctcacgtggcgacgtatctttttctctcacacacactacaccccgaatcgattacrtaccgcgagagatcacacagtgtttcattttttatgtgtctgcaacacatcaactactcarcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgacttcggtcacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttattatcattttgtattactattgcgttatacaacaatttacaacacacacacactagatgtgatgtaatatatatagcactatattttaattctgtcacctacacacagaaatacatccttgttcgttgttttttttcacgtaacgcaaaaagtcaatttcttgattttatgtttttactgaggcagtggcaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaacttgagtgaattctatttcatctcgattttgtgagtaacttacgcgtaactttttttttatagattcgcacctcgcgtctctttagatttttaattttatgcgttcgacgctgtttagaacacacgctaaattttttacacggcactcactcgcctttagaatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagccttaggaagaaattccactgcatacgttctcgcacacacacacacacaccgcagctcatatgcaggcgacgcacatgttaataccgccgcgtagatttttatttcttcttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatattttttttatgcacacagcacacagcatacacacacacacacacatactgtgtcgccccgtgtctcaaaaaatatatacactttacaatgaagaacgaagggttgggagatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttctcgtaaattgcaaatttcctcagctacaaaatgaattggcttgagctcgtattattcgtaatacgctcgcctcactattttcgtacggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcatactgcccgcagcgtatgccttcgggcatttcgttctgtcgtgtgtagttgacaattttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctctttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 3600

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 3600
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.4 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacaggcaatattaaatactactctaactatactctcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgttgtattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcatatgttccattcatttggttctattgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgtagcttctgtgcgtatagatgttgaatacacactttttgtgttatattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.5 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactctaactatactcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtgtaattgcgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatattttgctttattgcaattttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactctaactatactcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgctgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccatcatttgggttctgttttaaagtgtgtttttgctctgcgcgcggtaaagcttactgcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.2 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.6 | small subunit ribosomal RNA | s6-s14 region ccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgccatgaagaatgaatcttaacacctttctactctttgtgtcaacagttttacgtatatgttttgggcttatagttcatttcatatacgttcgacgctgttataagaattttgcttacgcatatacgatttttacacggcacgttagcatacacgcgtatatacaacctacacatacacacccacatttcgttgtatataccgtgtgtgacacacgcagcacttaatttcagaaatgtcttttcgtttgcatttgtgtgtgagacacactttggagcatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcgcactttcagccttttagaaagaagcctctcagcttttttctctctctcactcacacatacacacacacacacacacatcgtgaggaggcaaatactataagcgtatctttttttctaaaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattgtattacgctattagtatctctcacacacacacacacacacacatgtggtaacactaattatgcgtatatacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcaatttctatatagaattgtaaatttcctcaaactgcaaaataacttggcttgagctcgtatcattcttgatacgctcgcctcacttttttcgtacggtctcgacggacgtttcattttatcattttctttgcgtgtaagcattatgtatttattccttgaaacataggaattacattgcgtgcacttgattttcggagctttgcgctcaaatttctggtgagatgtaagcactgtgtttctctgcccgcagcgtatgactatcggtcatttcgttctgtcgtttggtagtttaacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccg

See sequence on NCBI

Specimen 3604

Species Rotaliida > Incertae sedis > Hyalinea > Hyalinea baltica
Isolate number 3604
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2002
Location Oslofjord, Norway

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatatcataatttatagtttatttacttcggtacttattctaatattatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggtccataaatttatgtatgttgcgacgcattgacccctcatttaattatgagcgctgcgtctttgtcgtttagctcatgcgattggatcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacttttatatgctgcgtacagttaatcctgtatgtattgtactgtaattgtgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattcatacatcgcatgcgcgagtccatttattctgtgctttcgggcactgttttaaatgtgtatctctgcgcgcgataaagcctacttcgaaagtaagtgggtaatcaattagaagtaatgatttccttaatttatagcacacatatatacggcagctttacccagccagccttgttgctggatcttgtgtgtattgctgctttttccgtatgtgcaattgtcaattcatggtgggggcagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttcagggactggagttattttcaaccctatggaaactgaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatccagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Hyalinea balthica | genomic DNA | 3604 | taxon:203415 | small subunit ribosomal RNA ttaagccatgcaagtggttatatcaacccgacagtttaaataagtgttaaattgctacacattataaacgcaacattattcatctacatacagtgaatactttttacacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattaaatattatgctatagcataaactgaactcacgcagtataatcgtatgctacaactacacacaaaaaaatgacatacgcgttctgtggaaggttagtgacctgcatagtaaatattaaaattaaaattgtttacaagctacgtacagtatctacgcagttgataccacacaacaactcactgcattttacgatctgtgcaagctgttttacaatgatttctctgtatcgcgttatacttacaagaacatgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtatttttaaaacacactgtaattgtgtaacataattatctctctacaggcgagtgcataacagcgcttaacggcagaatgaattattattcagcactttctacaacaacatactactcagcactcaatggtaagctttggttttttacgttcgcgtaattaccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtggtggggtaatttattcgtttcgccacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaaattacatagtattaatacaacaatttacaataaaacaagtttataaaacacgcacattataacacattatttcattctgtcctacagaatatcatacatatccttgttcgttgtaactcacgtaatttattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactacaatacatagaataataataaattctataagctagtttcgtacaaaaagtagcaatatatttgcagtacttactgttacagacactacatcacacacgaaacaacactgtgtctttcgtagctgcaagcctgtaaatagctatttttttacgtttcgacgcaccgtactaaattaatattattttattcatatagcttacggcaaccttgtaaataattacacacaaccaaatccattatttacgcggcagaattatactcgaattttttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgccttaattcaaacgcgttagaaatatttagctgtacgacagacatcacacacaaaccttacaatcactctgcgtactgttaatattatctaacacagtgccagtgacacatgaataatattttatatttctaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattaactattcgtttgcagactctatgcgaagctttttaaacgctgctatacacacaaacattttcagcacgtactatagctattaacatacgagtcaaactcgcgaatacttatataacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttacattaaattgcaaatttcctcagcctacaaaattactctggcttgagctcgtatttcgatacgctcgcctaatcaattttcgtacggtctctgatggacgtttcgtttaaaaatattttttgcgtgtaagcattgtattttatctttgaaacataagattatactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcatcatgtcattgctacccgcagtgtatatcttcgggtatttcatctgtcgtgcgtagctgacactttttcgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatatcataatttatagtttatttacttcggtacttattctaatattatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggtccataaatttatgtatgttgcgacgcattgacccctcatttaattatgagcgctgcgtctttgtcgtttagctcatgcgattggatcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacttttatatgctgcgtacagttaatcctgtatgtattgtactgtaattgtgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattcatacatcgcatgcgcgagtccatttattctgtgctttcgggcactgttttaaatgtgtatctctgcgcgcgataaagcctacttcgaaagtaagtgggtaatcaattagaagtaatgatttccttaatttatagcacacatatatacggcagctttacccagccagccttgttgctggatcttgtgtgtattgctgctttttccgtatgtgcaattgtcaattcatggtgggggcagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttcagggactggagttattttcaaccctatggaaactgaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatccagtaggtgaacct

See sequence on NCBI

Specimen C24

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C24
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.373

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactggagggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacaatgattactgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides lobatulus | genomic DNA | C24 | taxon:325267 | small subunit ribosomal RNA gtttaaataagtgttaaatgctaccattaaacttatcgtatatcacgcatagaccgattttgtttacggcagtaacaatttcagcgtgttatcacccatcacagtgaatcactgaaatttaccctacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgaaacaccctctcttttttgcgggggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaatttttttgatttctctgtatcgcttattctttaaggacattgcgttacaccgtgacaattttttctttatggataactcagggaaagtttggctaatacgtacgagtatatttttactacacatacgcacacacattcaaattaatttttgtatcgctgtgtatcaactactactcagcactcatggtaaactttggccacgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattcaaattgtatttacatgcgttacacaatttacaacattatacaagtttttaatgacagtacattataacactttcattttttctgttatcattacacatatatccttgttcgttgtactttcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatctgaatttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaatttctcattctgtttgaagttttacgcattaatatatatacatatttctatctcgcatagatttatttatttttttttgcgttcgacgctgttaaaatttatacaatttcaccgttgtattaaattttagtttttacacggcgcaaatttttactgcacacgcattatatagattttttctacgcacacacgctttatattttgccaacgcgggaaatctttgtatttttcgaacactcgcttaraatttattcgccttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgacgttaaaaatttttactgcactttttacaagcgctgtactttttttttccacacacgtttatctgtcatgctgcggcccgtttagggaagttatactagcatgcagggagagacgcacatgttacatgccacgtaaatattattatctcatactatccacggtaaattatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattattatatcttacgcacgctgcgtgacaatttttcctcactttgcttttatacggcattacacactgtacactgcgtatactgcgcattttggaatttttttcacacacagcgctgcgttatcatatatatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatggactctcaattgcattttttattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactacccgcagcatataccttcgggtattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacactctcctctgggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactggagggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacaatgattactgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen C29

Cibicidoides ungerianus_C29
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides ungerianus
Isolate number C29
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 195m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides ungerianus | genomic DNA | C29 | M. Schweizer C29 (UniGE) | taxon:349559 | small subunit ribosomal RNA aacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacttttttgcttcggcattgagtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtataatttttattacgcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggcgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggt

See sequence on NCBI

Specimen C35

Cibicidoides lobatulus_C35
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C35
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C35 | M. Schweizer C35 (UniGE) | taxon:325267 | small subunit ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctg

See sequence on NCBI

Specimen C37

Cibicidoides lobatulus_C37
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C37
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C37 | M. Schweizer C37 (UniGE) | taxon:325267 | small subunit ribosomal RNA cgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcaaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaac

See sequence on NCBI

Specimen C39

Cibicidoides lobatulus_C39
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C39
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C39 | taxon:325267 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen C40

Cibicidoides lobatulus_C40
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C40
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat Epizoic/Gastropod test
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | C40.3 | M. Schweizer C40 (UniGE) | taxon:325267 | small subunit ribosomal RNA ctgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgccttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaaagtgggtaaatcaattagaagtaatgattttcctttttttagcacacatatatacggcgtctatgcccgggattacctgttgtagcttttgtgcgtatagatgtttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen R3

Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R3
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R3 | taxon:944431 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggac

See sequence on NCBI

Specimen R6

Liebusella goesi_R6 Liebusella goesi_R6
Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R6
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 4 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttnntttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacctctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 5 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen U26

Uvigerina peregrina, Norway, Oslofjord
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U26
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2001
Habitat soft sediment
Depth 195m
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U26-1 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtttctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttactttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttctttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttctccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen U27

Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U27
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 195m
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtacattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatggattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacggggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcattgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaac

See sequence on NCBI

Other sequence

SSU total

>Uvigerina peregrina | genomic DNA | U27 | taxon:212521 | small subunit ribosomal RNA ctcaagattaagccatgcaagtggttacattaacccgacagtttaaataagtgttcaatgctatcacgcatatatgcaatgcatgcaaaaatatatttacgcatacacacacacacacccgcgcatatatattaaggcaagcaacgcatgaattttgtttacgatagtaacaaaatttcagcgtgaatcacacatacgcacacagtgaatcaaagcgaaattttacaatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacacacacacacacacacacgatttctctgtatcgcatattcatacaagaagaaaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacaatacacacacacacacacacacacactctatacamtactcaacactcagtgrtaatctttgatttaygtgtattcttacgcgtctatcawtataaagtttaatcgcaacatgagagacattgagcacgcacgtgtartgtgaatttattcacgttacacacccacgctgagcagactktgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatactatatttgcaatttactttattacgcattacgacactgtactattttattctgttatacacacacacacacacatccttgttcacacgcgtaagtaagttattatatatatacgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaattcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaatatgaattttttattcgctaataaattctatatttcagtattctcgcatatgtgtgatacacacacacacacacctacatacatatgcgttcgacgctgttatttcaaatatacgcgtcttgtatatttcttacggcaatttttttttctgcgacatgcacacacacacacacacacacacatttgtgcaccactcgcacacggggaaaatttttgtcactagtatttattcgcaatacacacacactcatatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcataccggttaaagatttacgtcttcgatcacacacacacatgttacgcatacacacatacacacgctttcgcgagcgcgcgtaatttacaaggtcgctaaatatttctttaacggttaaaaatgtcgatggagatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttgggctaggctatactctttgtgattatattatatacgtacacccacacacactcacacacacacatgtatattatttttttgcgcatacacacacacacacacttgcgcatcaacaattgttacatacacacgcgtatattttttaatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttattcacaataaattgcaaatttcctcagcctacaaaatttattcggcttgagctcgtgattctatcacgctcgcctatagtattttttcgtatggtctcgatggacgtttcatttatttatattttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttattctgcccgtaccgcgtatgtgttcactcacatttcgcctggtatccgtgtgcagtatttaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtacattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatggattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacggggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcattgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaac

See sequence on NCBI

Specimen U32

Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U32
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 195
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U32 | taxon:212521 | small subunit ribosomal RNA cgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatca

See sequence on NCBI

Specimen U67

Uvigerina peregrina_U67
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U67
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 87m
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U67 | taxon:212521 | small subunit ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgc

See sequence on NCBI