Specimens found in “North Sea, Langeoog, Germany” (3)

Specimen 12971

Rosalina sp. 1_12971
Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number 12971
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequences

SSU partial

>Rosalina sp. 12971 | genomic DNA | 12971 | taxon:987146 | 20 | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgatgattgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtctcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaactgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttggatgaatttcatttgtgtgcatacgggaggcttttctaaactagagggaccgctgttatcttctttagaccagaggaaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgccattcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtcaatctaaacttcgctttaganctttaagacctatggaaacttaaacgaacagtgtgntnnnnnnnaaagagaagtcgaacaaggcaaagg

See sequence on NCBI

SSU partial

>Rosalina sp. 12971 | genomic DNA | 12971 | taxon:987146 | 21 | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgagnattgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacagggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaatnananataatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtcaannnnaacttcgctttagatctttaagacctatggaaacttaaacgaacagtgtggtnnnnnnnaagagaagtcgaacaaggca

See sequence on NCBI

Specimen R1

Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number R1
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequence

SSU partial

>Rosalina sp. R1 | genomic DNA | R1 | taxon:944409 | North Sea | Sep-2010 | Christoph Hemleben | 18S rRNA | 18S rRNA | 18S ribosomal RNA tgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctctt

See sequence on NCBI

Specimen R2

Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number R2
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequence

SSU partial

>Rosalina sp. R2 | genomic DNA | R2 | taxon:944408 | North Sea | Sep-2010 | Christoph Hemleben | 18S rRNA | 18S rRNA | 18S ribosomal RNA tgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaa

See sequence on NCBI