Specimens found in “Skagerrak” (8)

Specimen 3966

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 3966
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Location Skagerrak

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3966 | taxon:313611 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagctgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttattttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtgtaaaggaaagagaagt

See sequence on NCBI

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3966 | taxon:313611 | 3966.27 | small subunit ribosomal RNA | s6-s14 region ccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgccatgaagaatgaatcttaacacctttctactctttgtgtcaacagttttacgtatatgttttgggcttatagttcatttcatatacgttcgacgctgttataagaattttgcttacgcatatacgatttttacacggcacgttagcatacacgcgtatatacaaccttacacatacacacccacatttcgttgtatataccgtgtgtgacacacgcagcacttaatttcagaaatgtcttttcgtttgcatttgtgtgtgagacacactttggagcatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcgcactttcagccttttagaaagaagcctctcagcttttttctctctctcactatcacacatacacacacacacacacacacatcgtgaggaggcaaatactataagcgtatctttttttctaaaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattgtattacgctattagtatctctcacatacacacacacacacacacacatgtggtaacactaattatgcgtatatacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcaatttctatatagaattgtaaatttcctcaacctgcaaaataacttggcttgagctcgtatcattcttgatacgctcgcctcacttttttcgtacggtctcgacggacgtttcattttatcattttctttgcgtgtaagcattatgtatttattccttgaaacataggaattacattgcgtgcacttgattttcggagctttgcgctcaaatttctggtgagatgtaagcactgtgtttctctgcccgcagcgtatgactatcggtcatttcgttctgtcgtttggtagtttaacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactactatactcgtatatgtgctgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccg

See sequence on NCBI

Specimen 6733

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6733
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6733 | taxon:1051367 | 1 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgaaagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagctaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgtgggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6733 | taxon:1051367 | 7 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacagcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcaatgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6733 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgaaagcttgcattgtcaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggtatgctcttacgggagttttactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttttacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacagtttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6735

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6735
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6735 | taxon:1051367 | 5 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaatgctatgttttctgtgtttgctgttcggttttgctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatttttctacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggagtttgttttaaagctttcgggtggagaagcaggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcaaacgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6735 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttactgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgnaagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggtatgctcttacgggagttttactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcttacgcttgaaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcaggttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccatttttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6735 | taxon:1051367 | 8 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cataccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 6737

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6737
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcaaacgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 7 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgnttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcagcctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 8 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaattagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen C120

Cibicidoides lobatulus_C120
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C120
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Depth 32m
Location Skagerrak
Latitude, Longitude 58.208, 11.241

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgccttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggtaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides lobatulus | genomic DNA | C120 | taxon:325267 | small subunit ribosomal RNA ctcaaagattaagccgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatcgatatatcacgatagaccgattttgtttacgacggcagtaacaatttcagcgtgttatcacccatcacagtgaatcactgaaatttaccctacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgaaacaccctctcttcattgcgggggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaatttttttgatttctctgtatcgcttattctttaaggacattgcgttacaccgtgacaattttttctttatggataactcagggaaagtttggctaatacgtacgagtatattttatttttactacacatacgcacatacattcagattaatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgcgtcttcggacgcttcacgtcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattcaaattgtatttacatgcgttacacaatttacaacattattacaagtttttaatgacagtacattataacactttcattttttctgttatcattacacatatatccttgttcgttgtactttcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaacttctcattctgtttgaagttttacgcattaatatatatttctatctcgcatagatttattttttttttgcgttcgacgctgttaaaatttatacaatttcaccgttgtattaaattttagtttttacacggcacaaatttttactgtcgcacacgcattatatatatacatcatttctacgcacacacacacacacgatttatatattttgcaaacgcgcgggaaatctttgtattttttcgaacactcgcttagttatttattcgccttttcaacactgtgaacaaatcaragtgtattaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgacgttaaagatttttactgcactttttacaagcgctgtacttgattttttccacacacgtttatctgtcatgctgcggcccgtttagggaagtatactagcatgcagggagagacgcacatgttacatgccacgtaaatattattatctcatactacccacacacggtaaattatttttaacggttaaaaaatgtcgatggggatagttggagtcaacagtattgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatatcttacgggacgctgctgtgctgcctgcgtgacacattttttttttctcagcattgctttatacggcattacacactgtacactgcgtatactgccatctttgcgaatttttttgtctcacacacagacacacacacacacagcgctgcgttatgcatatatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatggactctcaattgcattttttattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactacccgcagcatataccttcgggtattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacactctcctctgggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgccttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggtaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen U169

Uvigerina peregrina_169
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U169
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Habitat soft sediment
Depth 92m
Location Skagerrak
Latitude, Longitude 58.528, 11.0675

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U169-2 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctctgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen U184

Uvigerina peregrina_U184
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U184
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Habitat soft sediment
Depth 60m
Location Skagerrak
Latitude, Longitude 58.5815, 11.0543

Barcode sequences

SSU partial

>Uvigerina peregrina | genomic DNA | U184-5 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgctgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcccattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Uvigerina peregrina | genomic DNA | U184-2 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgactcctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcgtctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen U195

Uvigerina peregrina_U195
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U195
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Habitat soft sediment
Depth 60m
Location Skagerrak
Latitude, Longitude 58.5815, 11.0543

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U195-2 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggataa

See sequence on NCBI