Specimens found in “Portugal, Nazaré Canyon” (8)

Specimen C196

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides pachyderma
Isolate number C196
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.385, -9.1699

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacaggccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides pachyderma | genomic DNA | C196 | taxon:349560 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttcaatgctacattaaacttatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgaatcacccatcacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcagctcggtgaatttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtactttaccacacacacacacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgcatcaactactactcagcactcagtggtaaactttggccgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgaccccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattataacactttcattttttctgttatattacacacatatatatccttgttcgttgtattcagcatccataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgctcgtgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgagctgcaaatacgaatgaatttctcattctgtttgaagttttacgctttaatcactcgtgattttttgcgttcgacgcctgttaaaatttatacaattttttctgttgtattaaatttttcatttacacggcacaaatattttctgccgcatacattttattacatcacacacacacacacacacacgttgtaataataataaacgtatgcatttcaacgctgaaaacttttgtattcaaacactcgtttaaaatttattctccttttcaacactgtgaacaaatcagagtgtatcaaacatgtcnttttgaatgtgcattgaatgtcttatcatgagatgttgcactttctgcgtwaaaaatttttattgcctgtttacagcgctgtattcatttttagcattacacacacacacagcacgcacatgttacatgccacgtaaataatttttctatacatacgataaatttttttaacggttaaaaatgtcgataggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactytttgtgattatatttttatgcgacgtagcttacgctgaaatttttttgcattacacacatacacacactgcatcaaattttttttttggcgcttcgctgcagcatatacatatatatacactttacaatgaagaacgaaggttgggggatcaaagagggtcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttttattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcacactacccgcagcatatgtcttcgggcattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacaggccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacct

See sequence on NCBI

Specimen C86

Cibicidoides pachyderma_C86
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides pachyderma
Isolate number C86
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 338m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.3891, -9.1471

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides pachyderma | genomic DNA | C86 | taxon:349560 | small subunit ribosomal RNA catgcaagtggttatattaacccgacagtttaaataagtgttcaatgctacattaaacttatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgaatcacccatcacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcagctcggtgaatttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtactttaccacacacacacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcartggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctaataccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatccataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagcggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaatttctcattctgtttgaagttttacgctttaatcactcgtgattttttgcgttcgacgcctgttaaaatttatacaattttttctgttgtattaaatttttcatttacacggcacgaatattttctgccgcatacattttattacaccacacacacacacacacacacgttgtaataataaacgtatgcatttcaacgctgaaaacttttgtattcraacactcgtttaraatttattctccttttcaacactgtgaacaaatcagtgtgtatcaaacatgtckttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgcgttaaaaatttttattgcctgtttacagcgctgtattcatttttagcattacacacacacacagcacgcacatgttacrtgccacgtaaataatttttctatacatacgataaatttttttaacggttaaaartgtcgatggrgatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatttttatgcgacgtagcttacgctgaaatttttttgcattacacacacacacacactgcatcaaatttttttttggcgcttcgctgcagcatatacatatatatacactttacaatgaagaacgaaggttgggggatcaaagagaatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatcttttattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcacactacccgcagcatatgtcttcgggcattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcntactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen C87

Cibicidoides pachyderma_C87
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides pachyderma
Isolate number C87
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 338m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.3891, -9.1471

Barcode sequence

SSU partial

>Cibicides pachyderma x kullenbergi | genomic DNA | C87 | T. Kouwenhoven C87 (UniGE) | taxon:378218 | small subunit ribosomal RNA caagcttgatatgcaagcgaacctaatgmgkgatcgcacgtattatgttaaatatgctagtyctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcag

See sequence on NCBI

Specimen U239

Uvigerina phlegeri_U239
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina phlegeri
Isolate number U239
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 321m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.388, -9.15

Barcode sequences

SSU partial

>Uvigerina phlegeri | genomic DNA | U239-2 | taxon:503359 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttctctctcgcactctcacgagtgtgtgtgctgtaaagtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcactaagggcctatacaattacgtatgttgttattgcactttgacccctccttcgcgggtgcgtgtgtctttgactgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagttatatttttattttatgctttaccgcatatatactaatttgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattatacaccgcatgcgcgagtccatttattcattttaccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcattgcgtatatcttatgcgctctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Uvigerina phlegeri | genomic DNA | U239-5b | taxon:503359 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttctcgcactctcgagtgtgctgtaaagtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattgcactttgacccctccttcgcgggtgcgtgtgtctttgactgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagttatatttttattttatgctttaccgcatatatactaatttgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattatacaccgcatgcgcgagtccatttattcattttaccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcattgcgcgtatatttcatatgcgctctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaagctgcagaaggatca

See sequence on NCBI

Specimen U273

Uvigerina elongatastriata_U273
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina elongatastriata
Isolate number U273
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 151m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.385, -9.1699

Barcode sequences

SSU partial

>Uvigerina elongatastriata | genomic DNA | U273-5 | taxon:212520 | small subunit ribosomal RNA aacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacacacacacacacacgcgcgctctcacgtgctgttgtgtgtgctgtagtgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggttcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaatttacgtatgtcagttatttttttacactttgacccctctgcttcacgtttcattacgctgcagtgcgtgtgtctttgttcttataaattaactcatacaatttaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttctttacgtgggtattaactacactcacacacatatacacactgcgtgtaaatgtgcgcgaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttatacaccgcatgcgcgagtccatttatttagcatcgtgtatttacgtacgcgtgtttttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttcctatttttttatattntgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgtgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtnttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgctgtaaatatattttttttttacgaatatattctta

See sequence on NCBI

SSU partial

>Uvigerina elongatastriata | genomic DNA | U273-4b | taxon:212520 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacacacacacacacacgcgctctcacgtgctgttgtgtgtgctgtagtgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaatttacgtatgtcagttatttttttacactttgacccctctgcttacgtttcattacgctgcagtgcgtgtgtctttgttctataaattaactcatacaatttaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttctttatgtgggtattaactacactcacacacatatacacacatgcgtgtaaatgtgcgcgaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttatacaccgcatgcgcgagtccatttatttagcatcgtgtatttacgtacgcgtgttttttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttcctatttttttatattctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctyttaccgatggacttctntgtgagtttgagggactgggaacgctgtaaatatattttttttttacgaatatattcttatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI