Specimens found in “Portugal, Setubal Canyon” (1)

Specimen C184

Cibicidoides Wuellerstorfi_C184
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides wuellerstorfi
Isolate number C184
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 2774m
Location Portugal, Setubal Canyon
Latitude, Longitude 38.1202, -9.1699

Barcode sequence

SSU partial

>Cibicides wuellerstorfi | genomic DNA | C184 | taxon:325266 | small subunit ribosomal RNA aagggcaccatcaagacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactttgcttcggcattgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgtatcgcacttcgacccctttctttaattagaaagcgcgtgtcttagtttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI