Specimens found in “Mediterranean Sea, Marseille, France” (5)

Specimen C170

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C170
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggcaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttctttaattagagagcgcgcgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcctgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggacgcagaaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtgtaacaaggca

See sequence on NCBI

Other sequence

SSU total

>Cibicides lobatulus | genomic DNA | C170 | taxon:325267 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataggtgttaaatgctaccattaaacttatcgtatatcacgcatagaccgattttgtttacggcagtaacaatttcagcgtgttatcacccatcacagtgaatcactgaaatttaccctacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgagacaccctctctctctctctctcttttgcgggactgactgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaatttttttgatttctctgtatcgcttattctttaaggatcattgcgttacaccgtgacaatttttttctttatggataactcagggaaagtttggctaatacgtacgagtatatatttttttatttacccacatacgcacacacactcaaattaatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgcgagtaccctacaattcaaattgtatttacatgcgttatcaacaatttacaacattacatacaagtttttaatgacagcacattataacactttcattttattctgttatcattatacacatatatccttgttcacgttgtactttcagcatattataatattaatttattattatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttnnatgtatctgaatttcaagttgagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaatttctcattctgtttgaagttttacgcattaattatatacgtatatatttctgcgcgtctcgcacgcatagatttattattattattttttctgcgttcgacgctgttaaaatttatacaatttcaccgttgtattaaattttagtttttacacggcgcaaatttttactgcacacgcattatatattatttttctacgcacacaccctttatgtattttgccaacgcgggaaatatttgtgattcgaacactcgcttagaatttattcgccttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgacgttaaaaatttttacgtgcctctgttttacaagcgctgtacattattttttacacacacgtttatctgtcatgctgcggcccgtttagggaagttatactagcatgcagggagagacgcacatgttacatgccacgtaaatattattatctcaatactcttttacggtaaattatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatatattttacgcacgctacgctgcagtgataattttttcgccattgctttatacggtattacacacactgtacactgcgtatactgccattttgaaatttttactcacacacacacagcacacgcgctgcgttatcatatacatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatggactctcaattgcattttttattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactacccgcagcatataccctcgggtattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacactctcctctgggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggcaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttctttaattagagagcgcgcgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcctgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggacgcagaaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtgtaacaaggca

See sequence on NCBI

Specimen C171

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C171
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on November 2001
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C171.2 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacaccctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacggaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C171.4 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacacggcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C171.6 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA attgacaggcaatattaatattacactctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggaactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttattaaaccaagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgaagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatataccgcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen C172

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C172
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C172.1 | D. Longet C172 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagcgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C172.6 | D. Longet C172 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgcatcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacgcctatggaaacttaaac

See sequence on NCBI

Specimen C173

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C173
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C173.1 | D. Longet C173 (UniGE) | taxon:212459 | small subunit ribosomal RNA annaggtaaatagntgtttcaanngnnncnntcncaattccacacaacatacnnnncggattcgattagctatgcgtatatttgctatacacacgctttagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgcgttaaaaatttattactgcttcgtgctgtaattatttttttacacacacacacacacacatacgcacatgttgtatgccacgtaaataatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatatattttatcacgcataaatatacacacacacacatacacactcacgtatatacatgcggtcagtatatatacatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcaacctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttatactatccgcagcatatgtcttcgggcattttgtctgtcgtgtttagttaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacatgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgttttaaatgtgtatctctgcacgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaggactgggaacgcatataatttcgattatttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaac

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C173.1b | D. Longet C173 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacatgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgttttaaatgtgtatctctgcacgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattatttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaac

See sequence on NCBI

SSU partial

>Cibicides lobatulus | genomic DNA | 576 | J. Pawlowski 576 (UniGE) | taxon:325267 | small subunit ribosomal RNA accgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgca

See sequence on NCBI

Specimen C208

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C208
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequence

SSU partial

>Cibicides refulgens | genomic DNA | C208.6 | F. Sinniger C208 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtgtaaca

See sequence on NCBI