Specimens found in “Mediterranean Sea, Planier Canyon, France” (1)

Specimen C78

Cibicides refulgens_C78
Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C78
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on November 2002
Depth <10m
Location Mediterranean Sea, Planier Canyon, France
Latitude, Longitude 43.02, 5.12

Barcode sequence

SSU partial

>Cibicides refulgens | genomic DNA | C78 | J.-P. Gillig C78 (UniGE) | taxon:212459 | small subunit ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtcctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagttgagggactgggaacgcatataattcgattacttgcacacctatggaacttaacgaacagtgtgtct

See sequence on NCBI