Specimens found in “Mediterranean Sea” (1)

Specimen C218

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C218
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2004
Location Mediterranean Sea

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactacactctcttcagagatgtgtattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatgaaaactaaaccgaaaag

See sequence on NCBI

Other sequence

SSU total

>Cibicides refulgens | genomic DNA | C218 | taxon:212459 | small subunit ribosomal RNA tatattaacccgacagtttaaataagtgttaaatgctacattattaaacttacatcatatcacgcataccacgattttgtttaccgtagtaacaatttcagcgtgacgcacatatatcttcgcgatatagtgaatcactgaaatttacccattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataatatacaatgaaattttcatttcgaaatatatactcgctcgcgggtgtatgtgacggccgaattttttatttttattatttttttttgttgccttcacacgcactacaaaaatttatatattgatttctctgtatcgcttattcttaaggacaakgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtacattttacaccacacacacacacacacacacatacacnnantatatatttttgtatctacgctgtgtawcaacaatacatacatcmttactcmkcactcaatggtaakcttwggctgcgttcgcgtagccagttyaaagttwaactgcaacatgagagacattgacgcacgcacgtgttgtatcttcgggtacytcacatcacgctgagcagactakgckaagtttastttgcgaagcatrtcatacaagcatmtacagcaycaagtcacagggygtggswrtgtgtattttttgmacctycmamgcastcmcgcawassgaagagtagtttmtgatcccatagaaggagcrccgcacaatgagagaccgctcttagttttaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccgtacaatactaattgtattttacaatgcgttaaaccaattcacataccaacaagtttatacataatattacacatataacacttctattttttctgttgatgttaatttacatcaattagaacatacatacatatccttgttcgttgtttatttatcagcatcataatattattattatattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctctcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaatatttcacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttgttgcggttaagaggctcgtagttggattgaactgcacgtatgcgaatgaatttctcattctgtttggaagtttttttacgctttatttaattctgaattatttattgcgttcgacgctgttacaaaatttttattttttacacgggacaaatatacatatacgtatatatcacacacacacatacccattcgatatatataagctatgcgtatatttgcgtatatttgctatacacacgctttagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgcgttaaaaatttattactgcttcgtgctgtaattatttttcacacacacacacacacacacacacacatacgcacatgttgtatgccacgtaaataatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagagagagcagttgggtagggtatactctttgtgattatatatattttatcacgcataaatatacacacacacacatacacactcacgtatatacatgcggtcagtatatatacatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcaacctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttatactatccgcagcatatgtcttcgggcattttgtctgtcgtgtttagttaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactacactctcttcagagatgtgtattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatgaaaactaaaccgaaaag

See sequence on NCBI